Incidental Mutation 'R6444:Znhit1'
ID 519122
Institutional Source Beutler Lab
Gene Symbol Znhit1
Ensembl Gene ENSMUSG00000059518
Gene Name zinc finger, HIT domain containing 1
Synonyms 2700001K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock # R6444 (G1)
Quality Score 167.009
Status Validated
Chromosome 5
Chromosomal Location 136982164-136988021 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136982400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 153 (V153A)
Ref Sequence ENSEMBL: ENSMUSP00000115929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
AlphaFold Q8R331
Predicted Effect probably benign
Transcript: ENSMUST00000004968
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034953
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085941
AA Change: V154A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111090
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111091
AA Change: V158A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156963
AA Change: V153A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518
AA Change: V153A

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Other mutations in Znhit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Znhit1 APN 5 136982583 nonsense probably null
IGL02401:Znhit1 APN 5 136982659 missense probably damaging 1.00
R0032:Znhit1 UTSW 5 136985047 missense possibly damaging 0.49
R5107:Znhit1 UTSW 5 136986828 missense probably benign
R5240:Znhit1 UTSW 5 136982381 splice site probably null
R5710:Znhit1 UTSW 5 136982602 missense probably damaging 1.00
R6148:Znhit1 UTSW 5 136982633 missense probably benign 0.00
R6683:Znhit1 UTSW 5 136982633 missense probably benign 0.00
R8985:Znhit1 UTSW 5 136982554 missense probably damaging 1.00
R9566:Znhit1 UTSW 5 136986931 intron probably benign
X0028:Znhit1 UTSW 5 136985000 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATACCCCAGAATGAGCAGGC -3'
(R):5'- ATCCCCGTATACCTGTGTGAGC -3'

Sequencing Primer
(F):5'- AGGCCGTTTATTATCACAGCAC -3'
(R):5'- CCGTATACCTGTGTGAGCTGTGG -3'
Posted On 2018-05-24