Incidental Mutation 'R6444:A430033K04Rik'
ID 519124
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene Name RIKEN cDNA A430033K04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6444 (G1)
Quality Score 217.468
Status Validated
Chromosome 5
Chromosomal Location 138622859-138652414 bp(+) (GRCm38)
Type of Mutation small deletion (5 aa in frame mutation)
DNA Base Change (assembly) ACAGAGCAGTGCCTACCAG to ACAG at 138639569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032590] [ENSMUST00000069862] [ENSMUST00000198958] [ENSMUST00000200521]
AlphaFold E9Q8G5
Predicted Effect probably benign
Transcript: ENSMUST00000032590
SMART Domains Protein: ENSMUSP00000032590
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
KRAB 36 96 6.23e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069862
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198958
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200521
SMART Domains Protein: ENSMUSP00000143566
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
R8170:A430033K04Rik UTSW 5 138647053 missense possibly damaging 0.72
R8348:A430033K04Rik UTSW 5 138636252 missense probably damaging 1.00
R8496:A430033K04Rik UTSW 5 138646858 missense probably benign 0.00
R8520:A430033K04Rik UTSW 5 138646706 missense possibly damaging 0.72
R8778:A430033K04Rik UTSW 5 138646887 missense possibly damaging 0.53
R8858:A430033K04Rik UTSW 5 138640076 missense probably benign 0.01
R9147:A430033K04Rik UTSW 5 138646285 missense possibly damaging 0.86
R9148:A430033K04Rik UTSW 5 138646285 missense possibly damaging 0.86
R9418:A430033K04Rik UTSW 5 138647055 missense probably damaging 1.00
R9645:A430033K04Rik UTSW 5 138646531 missense probably benign 0.33
R9661:A430033K04Rik UTSW 5 138647189 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATCCATTGTGGCAAAGACCC -3'
(R):5'- CCACAGAGCAGTAGAGAGTTTG -3'

Sequencing Primer
(F):5'- CCCTAAAAATAGGACTGTTGTCTCC -3'
(R):5'- TCTACAGATTGAGTTCCAGGACAGC -3'
Posted On 2018-05-24