Incidental Mutation 'R6444:Cped1'
ID 519125
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Name cadherin-like and PC-esterase domain containing 1
Synonyms A430107O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R6444 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 21985916-22256404 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21986931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 41 (I41L)
Ref Sequence ENSEMBL: ENSMUSP00000138562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115382] [ENSMUST00000115383] [ENSMUST00000153922]
AlphaFold B2RX70
Predicted Effect probably benign
Transcript: ENSMUST00000115382
AA Change: I41L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111040
Gene: ENSMUSG00000062980
AA Change: I41L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115383
AA Change: I41L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: I41L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151315
SMART Domains Protein: ENSMUSP00000116822
Gene: ENSMUSG00000062980

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153922
AA Change: I41L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138562
Gene: ENSMUSG00000062980
AA Change: I41L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180395
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0130:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1033:Cped1 UTSW 6 22016951 missense probably damaging 0.99
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1300:Cped1 UTSW 6 22119553 missense probably benign 0.00
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
R7387:Cped1 UTSW 6 22059934 missense probably benign 0.01
R7493:Cped1 UTSW 6 22215513 missense probably damaging 1.00
R7720:Cped1 UTSW 6 22222431 missense probably damaging 1.00
R7747:Cped1 UTSW 6 22143974 missense probably damaging 1.00
R7966:Cped1 UTSW 6 22059954 critical splice donor site probably null
R8113:Cped1 UTSW 6 22233481 missense possibly damaging 0.89
R8186:Cped1 UTSW 6 22123588 missense probably benign 0.01
R8215:Cped1 UTSW 6 22132278 missense probably damaging 1.00
R8265:Cped1 UTSW 6 22222427 missense probably benign 0.04
R8280:Cped1 UTSW 6 21986821 missense unknown
R8286:Cped1 UTSW 6 22254602 missense probably benign 0.03
R8393:Cped1 UTSW 6 22222466 missense possibly damaging 0.80
R8503:Cped1 UTSW 6 22145565 missense probably benign 0.02
R8725:Cped1 UTSW 6 22059942 missense possibly damaging 0.71
R8727:Cped1 UTSW 6 22059942 missense possibly damaging 0.71
R8852:Cped1 UTSW 6 22215621 missense probably damaging 1.00
R8881:Cped1 UTSW 6 22119579 missense possibly damaging 0.58
R8888:Cped1 UTSW 6 22016963 missense possibly damaging 0.51
R8983:Cped1 UTSW 6 22138687 missense probably benign 0.00
R9135:Cped1 UTSW 6 21987013 missense probably damaging 0.98
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTCACACTGACAACGTGGC -3'
(R):5'- TAATACCTCTCCCAGTCACCGG -3'

Sequencing Primer
(F):5'- ACTGACAACGTGGCCAGGG -3'
(R):5'- TCCCATTCGGACCACATGG -3'
Posted On 2018-05-24