Mutagenetix > Incidental Mutation

Incidental Mutation 'R6444:Cped1'

519125

Institutional Source

Beutler Lab

Gene Symbol

Cped1

Ensembl Gene

ENSMUSG00000062980

Gene Name

cadherin-like and PC-esterase domain containing 1

Synonyms

A430107O13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R6444 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21985916-22256404 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 21986931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 41 (I41L)

Ref Sequence

ENSEMBL: ENSMUSP00000138562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115382] [ENSMUST00000115383] [ENSMUST00000153922]

AlphaFold

B2RX70

Predicted Effect

probably benign
Transcript: ENSMUST00000115382
AA Change: I41L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000111040
Gene: ENSMUSG00000062980
AA Change: I41L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115383
AA Change: I41L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: I41L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC
Pfam:Cadherin-like	574	663	1e-9	PFAM
Pfam:PC-Esterase	753	1018	2e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141064

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151315

SMART Domains

Protein: ENSMUSP00000116822
Gene: ENSMUSG00000062980

Domain	Start	End	E-Value	Type
low complexity region	83	95	N/A	INTRINSIC
low complexity region	106	120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153922
AA Change: I41L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000138562
Gene: ENSMUSG00000062980
AA Change: I41L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	130	142	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180395

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACAGAGCAGTGCCTACCAG	ACAG	5: 138,639,569		probably benign	Het
Bcas2	T	A	3: 103,172,046		probably null	Het
Camk1d	A	T	2: 5,313,145	I233N	probably damaging	Het
Chd2	T	C	7: 73,501,037		probably null	Het
Cnot2	T	C	10: 116,499,355	D246G	probably benign	Het
Dcdc2c	A	G	12: 28,535,476	V174A	probably damaging	Het
Dscam	G	A	16: 96,619,644	R1681C	probably damaging	Het
Dysf	G	A	6: 84,190,840	V1755M	probably benign	Het
Eif5b	G	A	1: 38,036,211	D590N	probably damaging	Het
Fntb	A	G	12: 76,916,440	Y399C	probably damaging	Het
Galns	T	C	8: 122,611,338	M1V	probably null	Het
Galnt15	T	C	14: 32,040,411	F199L	probably damaging	Het
Gm8229	A	T	14: 44,365,471	H38L	unknown	Het
Magel2	T	C	7: 62,379,999	Y884H	unknown	Het
Miga1	A	T	3: 152,283,831	V473E	probably damaging	Het
Mrgprx1	C	T	7: 48,021,814	V62I	possibly damaging	Het
Mybl1	G	A	1: 9,685,692	P211S	possibly damaging	Het
Myo19	A	G	11: 84,895,308	H254R	probably benign	Het
Myo1h	A	G	5: 114,314,956	T6A	possibly damaging	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Olfr1475	A	T	19: 13,479,430	M256K	possibly damaging	Het
Olfr44	T	C	9: 39,484,318	T309A	probably benign	Het
Psmd12	A	G	11: 107,486,454	E113G	possibly damaging	Het
Ptpn3	T	C	4: 57,195,730	D879G	possibly damaging	Het
Rufy3	A	G	5: 88,637,307	Q414R	probably damaging	Het
Slc14a2	A	G	18: 78,154,102	I813T	probably damaging	Het
Smok2a	G	T	17: 13,225,613	A26S	probably benign	Het
Spsb3	T	A	17: 24,891,576	L459Q	probably damaging	Het
Tacc2	T	C	7: 130,623,412	V609A	possibly damaging	Het
Tmem185b	C	A	1: 119,526,635	A42E	probably damaging	Het
Trim56	A	G	5: 137,112,616	V682A	probably damaging	Het
Trim75	T	C	8: 64,982,836	K321E	possibly damaging	Het
Ttc17	A	C	2: 94,303,546	M1098R	possibly damaging	Het
Ydjc	C	A	16: 17,147,681	H136Q	probably damaging	Het
Zfp568	A	T	7: 30,017,257	H193L	probably benign	Het
Znhit1	A	G	5: 136,982,400	V153A	probably benign	Het

Other mutations in Cped1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cped1	APN	6	22215523	missense	probably damaging	1.00
IGL00909:Cped1	APN	6	22122427	splice site	probably benign
IGL01434:Cped1	APN	6	22017005	missense	probably damaging	0.99
IGL01572:Cped1	APN	6	22051301	missense	probably benign	0.00
IGL02063:Cped1	APN	6	22138702	missense	probably damaging	0.98
IGL02216:Cped1	APN	6	22059945	missense	probably damaging	1.00
IGL02257:Cped1	APN	6	22145607	missense	possibly damaging	0.86
IGL02541:Cped1	APN	6	22120989	missense	probably benign	0.00
IGL03008:Cped1	APN	6	22233602	missense	probably benign	0.01
IGL03237:Cped1	APN	6	22233596	missense	probably damaging	1.00
PIT4382001:Cped1	UTSW	6	22222450	nonsense	probably null
PIT4812001:Cped1	UTSW	6	22122294	missense	probably benign	0.02
R0048:Cped1	UTSW	6	22119602	missense	probably benign	0.08
R0128:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0130:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0267:Cped1	UTSW	6	22119476	missense	probably damaging	0.99
R0374:Cped1	UTSW	6	22222546	splice site	probably benign
R0482:Cped1	UTSW	6	22016958	missense	probably benign	0.32
R0734:Cped1	UTSW	6	22085041	missense	probably damaging	1.00
R1033:Cped1	UTSW	6	22016951	missense	probably damaging	0.99
R1118:Cped1	UTSW	6	22237699	missense	probably benign	0.19
R1181:Cped1	UTSW	6	22215562	missense	probably damaging	0.99
R1300:Cped1	UTSW	6	22119553	missense	probably benign	0.00
R1485:Cped1	UTSW	6	22132388	critical splice donor site	probably null
R1507:Cped1	UTSW	6	22122261	missense	probably damaging	1.00
R1830:Cped1	UTSW	6	22237728	missense	probably damaging	1.00
R1879:Cped1	UTSW	6	22085015	splice site	probably null
R1902:Cped1	UTSW	6	22120981	splice site	probably null
R1991:Cped1	UTSW	6	22233927	missense	probably damaging	1.00
R2020:Cped1	UTSW	6	22143964	missense	probably benign	0.38
R2883:Cped1	UTSW	6	22143979	missense	probably damaging	1.00
R3011:Cped1	UTSW	6	22088696	missense	probably damaging	1.00
R4466:Cped1	UTSW	6	22123652	missense	probably benign	0.29
R4668:Cped1	UTSW	6	22237653	missense	probably benign	0.06
R4808:Cped1	UTSW	6	22088757	missense	probably damaging	1.00
R5402:Cped1	UTSW	6	22143952	missense	probably benign	0.05
R5417:Cped1	UTSW	6	22233580	missense	probably null	0.01
R5741:Cped1	UTSW	6	22123621	missense	probably benign	0.02
R5821:Cped1	UTSW	6	22138682	missense	probably benign	0.00
R5977:Cped1	UTSW	6	22254608	missense	probably damaging	1.00
R6255:Cped1	UTSW	6	22138715	splice site	probably null
R6304:Cped1	UTSW	6	22016923	missense	probably benign	0.14
R6416:Cped1	UTSW	6	22123649	missense	probably damaging	1.00
R6617:Cped1	UTSW	6	22215547	nonsense	probably null
R6650:Cped1	UTSW	6	22233976	missense	probably damaging	1.00
R7048:Cped1	UTSW	6	22119470	missense	probably benign	0.36
R7083:Cped1	UTSW	6	22123580	missense	probably benign	0.01
R7234:Cped1	UTSW	6	22254626	missense	probably damaging	0.99
R7387:Cped1	UTSW	6	22059934	missense	probably benign	0.01
R7493:Cped1	UTSW	6	22215513	missense	probably damaging	1.00
R7720:Cped1	UTSW	6	22222431	missense	probably damaging	1.00
R7747:Cped1	UTSW	6	22143974	missense	probably damaging	1.00
R7966:Cped1	UTSW	6	22059954	critical splice donor site	probably null
R8113:Cped1	UTSW	6	22233481	missense	possibly damaging	0.89
R8186:Cped1	UTSW	6	22123588	missense	probably benign	0.01
R8215:Cped1	UTSW	6	22132278	missense	probably damaging	1.00
R8265:Cped1	UTSW	6	22222427	missense	probably benign	0.04
R8280:Cped1	UTSW	6	21986821	missense	unknown
R8286:Cped1	UTSW	6	22254602	missense	probably benign	0.03
R8393:Cped1	UTSW	6	22222466	missense	possibly damaging	0.80
R8503:Cped1	UTSW	6	22145565	missense	probably benign	0.02
R8725:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8727:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8852:Cped1	UTSW	6	22215621	missense	probably damaging	1.00
R8881:Cped1	UTSW	6	22119579	missense	possibly damaging	0.58
R8888:Cped1	UTSW	6	22016963	missense	possibly damaging	0.51
R8983:Cped1	UTSW	6	22138687	missense	probably benign	0.00
R9135:Cped1	UTSW	6	21987013	missense	probably damaging	0.98
X0022:Cped1	UTSW	6	21987046	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTTCACACTGACAACGTGGC -3'
(R):5'- TAATACCTCTCCCAGTCACCGG -3'

Sequencing Primer
(F):5'- ACTGACAACGTGGCCAGGG -3'
(R):5'- TCCCATTCGGACCACATGG -3'

Posted On

2018-05-24