Incidental Mutation 'R6444:Mrgprx1'
ID519128
Institutional Source Beutler Lab
Gene Symbol Mrgprx1
Ensembl Gene ENSMUSG00000070552
Gene NameMAS-related GPR, member X1
SynonymsMrgprc11, MrgC11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location48020971-48027597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48021814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 62 (V62I)
Ref Sequence ENSEMBL: ENSMUSP00000091954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094390
AA Change: V62I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091954
Gene: ENSMUSG00000070552
AA Change: V62I

DomainStartEndE-ValueType
Pfam:7tm_1 43 202 1.9e-7 PFAM
low complexity region 227 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Mrgprx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Mrgprx1 APN 7 48021486 missense probably benign 0.00
IGL01326:Mrgprx1 APN 7 48021769 missense probably benign 0.26
IGL02117:Mrgprx1 APN 7 48021623 nonsense probably null
IGL02219:Mrgprx1 APN 7 48021729 missense probably benign 0.20
IGL02431:Mrgprx1 APN 7 48021127 missense probably benign 0.00
IGL02441:Mrgprx1 APN 7 48021588 missense probably benign 0.39
IGL02682:Mrgprx1 APN 7 48021992 missense probably damaging 1.00
R0219:Mrgprx1 UTSW 7 48021546 missense probably damaging 1.00
R4366:Mrgprx1 UTSW 7 48021193 missense probably damaging 0.98
R4521:Mrgprx1 UTSW 7 48021699 missense probably benign
R4801:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R4802:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R5452:Mrgprx1 UTSW 7 48021808 missense probably benign 0.07
R5537:Mrgprx1 UTSW 7 48021150 missense probably benign
R6834:Mrgprx1 UTSW 7 48021637 missense probably damaging 0.99
R7406:Mrgprx1 UTSW 7 48021985 missense possibly damaging 0.62
RF020:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF024:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF026:Mrgprx1 UTSW 7 48021509 small insertion probably benign
RF043:Mrgprx1 UTSW 7 48021509 small insertion probably benign
Z1088:Mrgprx1 UTSW 7 48021129 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGCCACAATACACACAGG -3'
(R):5'- TGTGAGCATGGATCCAACCATC -3'

Sequencing Primer
(F):5'- TACACACAGGCAGCGCTCTG -3'
(R):5'- TGAGCATGGATCCAACCATCTCATC -3'
Posted On2018-05-24