Incidental Mutation 'R6444:Myo19'
ID519136
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Namemyosin XIX
SynonymsMyohd1, 1110055A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84880148-84911226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84895308 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 254 (H254R)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020837] [ENSMUST00000093969]
Predicted Effect probably benign
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093969
AA Change: H254R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: H254R

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174903
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84900220 missense probably damaging 1.00
BB014:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 splice site probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7921:Myo19 UTSW 11 84908238 missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84885710 missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84900220 missense probably damaging 1.00
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGCGTTCCTTTTCC -3'
(R):5'- AATGGAGCATGGCCTCTCTG -3'

Sequencing Primer
(F):5'- AGAGGCGTTCCTTTTCCCCATG -3'
(R):5'- TGGTCACCTCGAAACAATCCTCTG -3'
Posted On2018-05-24