Incidental Mutation 'R6444:Myo19'
ID 519136
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Name myosin XIX
Synonyms Myohd1, 1110055A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R6444 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84880148-84911226 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84895308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 254 (H254R)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020837] [ENSMUST00000093969]
AlphaFold Q5SV80
Predicted Effect probably benign
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093969
AA Change: H254R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: H254R

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174903
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84900220 missense probably damaging 1.00
BB014:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 splice site probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7921:Myo19 UTSW 11 84908238 missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84885710 missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R9105:Myo19 UTSW 11 84903203 missense probably damaging 0.99
R9714:Myo19 UTSW 11 84882716 start codon destroyed probably null 0.18
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGCGTTCCTTTTCC -3'
(R):5'- AATGGAGCATGGCCTCTCTG -3'

Sequencing Primer
(F):5'- AGAGGCGTTCCTTTTCCCCATG -3'
(R):5'- TGGTCACCTCGAAACAATCCTCTG -3'
Posted On 2018-05-24