Mutagenetix > Incidental Mutations

Incidental Mutation 'R6444:Psmd12'

519137

Institutional Source

Beutler Lab

Gene Symbol

Psmd12

Ensembl Gene

ENSMUSG00000020720

Gene Name

proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

Synonyms

1500002F15Rik, P55

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6444 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107479484-107504362 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107486454 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 113 (E113G)

Ref Sequence

ENSEMBL: ENSMUSP00000102363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]

Predicted Effect

probably benign
Transcript: ENSMUST00000021063
AA Change: E113G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: E113G

Domain	Start	End	E-Value	Type
PINT	349	435	3.24e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106750
AA Change: E93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: E93G

Domain	Start	End	E-Value	Type
PINT	329	415	3.24e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106752
AA Change: E113G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720
AA Change: E113G

Domain	Start	End	E-Value	Type
Pfam:PCI	300	398	1.3e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138702

Meta Mutation Damage Score

0.3433

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACAGAGCAGTGCCTACCAG	ACAG	5: 138,639,569		probably benign	Het
Bcas2	T	A	3: 103,172,046		probably null	Het
Camk1d	A	T	2: 5,313,145	I233N	probably damaging	Het
Chd2	T	C	7: 73,501,037		probably null	Het
Cnot2	T	C	10: 116,499,355	D246G	probably benign	Het
Cped1	A	C	6: 21,986,931	I41L	probably benign	Het
Dcdc2c	A	G	12: 28,535,476	V174A	probably damaging	Het
Dscam	G	A	16: 96,619,644	R1681C	probably damaging	Het
Dysf	G	A	6: 84,190,840	V1755M	probably benign	Het
Eif5b	G	A	1: 38,036,211	D590N	probably damaging	Het
Fntb	A	G	12: 76,916,440	Y399C	probably damaging	Het
Galns	T	C	8: 122,611,338	M1V	probably null	Het
Galnt15	T	C	14: 32,040,411	F199L	probably damaging	Het
Gm8229	A	T	14: 44,365,471	H38L	unknown	Het
Magel2	T	C	7: 62,379,999	Y884H	unknown	Het
Miga1	A	T	3: 152,283,831	V473E	probably damaging	Het
Mrgprx1	C	T	7: 48,021,814	V62I	possibly damaging	Het
Mybl1	G	A	1: 9,685,692	P211S	possibly damaging	Het
Myo19	A	G	11: 84,895,308	H254R	probably benign	Het
Myo1h	A	G	5: 114,314,956	T6A	possibly damaging	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Olfr1475	A	T	19: 13,479,430	M256K	possibly damaging	Het
Olfr44	T	C	9: 39,484,318	T309A	probably benign	Het
Ptpn3	T	C	4: 57,195,730	D879G	possibly damaging	Het
Rufy3	A	G	5: 88,637,307	Q414R	probably damaging	Het
Slc14a2	A	G	18: 78,154,102	I813T	probably damaging	Het
Smok2a	G	T	17: 13,225,613	A26S	probably benign	Het
Spsb3	T	A	17: 24,891,576	L459Q	probably damaging	Het
Tacc2	T	C	7: 130,623,412	V609A	possibly damaging	Het
Tmem185b	C	A	1: 119,526,635	A42E	probably damaging	Het
Trim56	A	G	5: 137,112,616	V682A	probably damaging	Het
Trim75	T	C	8: 64,982,836	K321E	possibly damaging	Het
Ttc17	A	C	2: 94,303,546	M1098R	possibly damaging	Het
Ydjc	C	A	16: 17,147,681	H136Q	probably damaging	Het
Zfp568	A	T	7: 30,017,257	H193L	probably benign	Het
Znhit1	A	G	5: 136,982,400	V153A	probably benign	Het

Other mutations in Psmd12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03002:Psmd12	APN	11	107485781	missense	probably benign	0.00
R0384:Psmd12	UTSW	11	107485721	missense	probably benign	0.00
R1457:Psmd12	UTSW	11	107479646	missense	probably damaging	1.00
R1661:Psmd12	UTSW	11	107491906	missense	probably damaging	1.00
R2443:Psmd12	UTSW	11	107495737	missense	probably damaging	1.00
R3806:Psmd12	UTSW	11	107495765	missense	probably benign	0.03
R3807:Psmd12	UTSW	11	107495765	missense	probably benign	0.03
R3840:Psmd12	UTSW	11	107485572	missense	probably benign	0.02
R4212:Psmd12	UTSW	11	107485759	missense	probably damaging	1.00
R4718:Psmd12	UTSW	11	107486433	missense	probably benign	0.15
R5182:Psmd12	UTSW	11	107479659	missense	probably damaging	1.00
R5586:Psmd12	UTSW	11	107486475	missense	probably benign	0.35
R6171:Psmd12	UTSW	11	107491907	missense	probably damaging	0.96
R6527:Psmd12	UTSW	11	107488968	missense	probably damaging	0.96
R7276:Psmd12	UTSW	11	107503645	nonsense	probably null
R7466:Psmd12	UTSW	11	107492057	missense	probably benign	0.03
R7751:Psmd12	UTSW	11	107479613	missense	possibly damaging	0.68
R7779:Psmd12	UTSW	11	107497579	missense	probably benign	0.01
R8373:Psmd12	UTSW	11	107497624	missense	probably damaging	0.98
Z1177:Psmd12	UTSW	11	107485557	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GGAATGTATCTATGGAATTTCCCTCC -3'
(R):5'- CACTTAATTCTGAGCCAGGTGTG -3'

Sequencing Primer
(F):5'- CCTTAATCCCAGCATTAGGTAGGG -3'
(R):5'- ACCTTTCATTTCAGAACCTGGGAGG -3'

Posted On

2018-05-24