Incidental Mutation 'R6444:Galnt15'
ID519140
Institutional Source Beutler Lab
Gene Symbol Galnt15
Ensembl Gene ENSMUSG00000021903
Gene Namepolypeptide N-acetylgalactosaminyltransferase 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32028989-32062197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32040411 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 199 (F199L)
Ref Sequence ENSEMBL: ENSMUSP00000022460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022460] [ENSMUST00000164208]
Predicted Effect probably damaging
Transcript: ENSMUST00000022460
AA Change: F199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022460
Gene: ENSMUSG00000021903
AA Change: F199L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 191 436 2e-8 PFAM
Pfam:Glycos_transf_2 194 362 9e-32 PFAM
RICIN 505 630 1.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164208
SMART Domains Protein: ENSMUSP00000131978
Gene: ENSMUSG00000021903

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
low complexity region 228 248 N/A INTRINSIC
RICIN 381 506 1.19e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228805
Meta Mutation Damage Score 0.6025 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Galnt15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Galnt15 APN 14 32052356 missense possibly damaging 0.47
IGL02491:Galnt15 APN 14 32056316 missense probably damaging 1.00
R0323:Galnt15 UTSW 14 32048085 missense probably damaging 0.99
R1900:Galnt15 UTSW 14 32049865 missense probably damaging 1.00
R4369:Galnt15 UTSW 14 32029539 missense possibly damaging 0.90
R4423:Galnt15 UTSW 14 32058269 missense possibly damaging 0.95
R4979:Galnt15 UTSW 14 32043290 missense probably damaging 0.99
R5093:Galnt15 UTSW 14 32049829 missense probably damaging 1.00
R5201:Galnt15 UTSW 14 32049865 missense probably damaging 1.00
R5254:Galnt15 UTSW 14 32058287 nonsense probably null
R5434:Galnt15 UTSW 14 32049843 missense possibly damaging 0.88
R5451:Galnt15 UTSW 14 32029911 missense probably benign 0.25
R5495:Galnt15 UTSW 14 32029817 missense probably damaging 0.97
R5874:Galnt15 UTSW 14 32052367 missense probably damaging 1.00
R6374:Galnt15 UTSW 14 32058159 missense probably damaging 0.96
R7798:Galnt15 UTSW 14 32029905 missense possibly damaging 0.52
R9007:Galnt15 UTSW 14 32049978 missense probably damaging 1.00
R9031:Galnt15 UTSW 14 32048070 missense probably damaging 0.99
Z1177:Galnt15 UTSW 14 32052365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCTGGGAGAGCCACTG -3'
(R):5'- CATTGGAAGCTTGCCTGTG -3'

Sequencing Primer
(F):5'- CTGGGAGAGCCACTGAACTG -3'
(R):5'- CCTGTGGGCTTGAACTCC -3'
Posted On2018-05-24