Incidental Mutation 'R6444:Ydjc'
ID 519142
Institutional Source Beutler Lab
Gene Symbol Ydjc
Ensembl Gene ENSMUSG00000041774
Gene Name YdjC homolog (bacterial)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6444 (G1)
Quality Score 110.008
Status Validated
Chromosome 16
Chromosomal Location 17144621-17160701 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 17147681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 136 (H136Q)
Ref Sequence ENSEMBL: ENSMUSP00000156140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000069064] [ENSMUST00000090192] [ENSMUST00000115702] [ENSMUST00000115706] [ENSMUST00000115711] [ENSMUST00000231493] [ENSMUST00000231597] [ENSMUST00000231708] [ENSMUST00000231726] [ENSMUST00000232344] [ENSMUST00000232479] [ENSMUST00000232139] [ENSMUST00000232033] [ENSMUST00000232540]
AlphaFold Q14BV6
Predicted Effect probably benign
Transcript: ENSMUST00000023452
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069064
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069864
Gene: ENSMUSG00000041774
AA Change: H136Q

DomainStartEndE-ValueType
Pfam:YdjC 7 288 1.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090192
SMART Domains Protein: ENSMUSP00000087658
Gene: ENSMUSG00000038965

DomainStartEndE-ValueType
UBCc 5 149 1.43e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115702
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111366
Gene: ENSMUSG00000041774
AA Change: H136Q

DomainStartEndE-ValueType
Pfam:YdjC 6 229 9.2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115706
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111371
Gene: ENSMUSG00000041774
AA Change: H136Q

DomainStartEndE-ValueType
Pfam:YdjC 6 229 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115711
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231539
Predicted Effect probably benign
Transcript: ENSMUST00000231597
Predicted Effect probably benign
Transcript: ENSMUST00000231708
Predicted Effect probably damaging
Transcript: ENSMUST00000231726
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231975
Predicted Effect probably damaging
Transcript: ENSMUST00000232344
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232479
AA Change: H136Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232139
Predicted Effect probably benign
Transcript: ENSMUST00000232668
Predicted Effect probably benign
Transcript: ENSMUST00000232033
Predicted Effect probably benign
Transcript: ENSMUST00000232540
Meta Mutation Damage Score 0.6887 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Ydjc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02834:Ydjc APN 16 17147289 missense probably benign 0.08
IGL02878:Ydjc APN 16 17147605 missense possibly damaging 0.74
R1659:Ydjc UTSW 16 17147839 missense possibly damaging 0.73
R1714:Ydjc UTSW 16 17147799 missense probably damaging 1.00
R2328:Ydjc UTSW 16 17147122 missense possibly damaging 0.93
R4857:Ydjc UTSW 16 17148138 unclassified probably benign
R6182:Ydjc UTSW 16 17147079 missense probably benign 0.00
R7341:Ydjc UTSW 16 17150898 missense probably benign 0.00
R7565:Ydjc UTSW 16 17147005 missense probably damaging 1.00
R8769:Ydjc UTSW 16 17150868 missense probably benign 0.00
R9170:Ydjc UTSW 16 17147802 missense probably benign
R9642:Ydjc UTSW 16 17148209 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTTCAAAGGCTGGAGCAGTC -3'
(R):5'- AGTTGGGAAGGCTGATGCTC -3'

Sequencing Primer
(F):5'- AAGGCTGGAGCAGTCGCATC -3'
(R):5'- AAGGCTGATGCTCACCGC -3'
Posted On 2018-05-24