Incidental Mutation 'R6444:Spsb3'
ID519145
Institutional Source Beutler Lab
Gene Symbol Spsb3
Ensembl Gene ENSMUSG00000024160
Gene NamesplA/ryanodine receptor domain and SOCS box containing 3
SynonymsSSB3, Tce1, 3300001M01Rik, 2310012N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6444 (G1)
Quality Score195.009
Status Validated
Chromosome17
Chromosomal Location24886643-24892152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24891576 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 459 (L459Q)
Ref Sequence ENSEMBL: ENSMUSP00000126878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000068508] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000121542] [ENSMUST00000168265] [ENSMUST00000154236] [ENSMUST00000146923] [ENSMUST00000130194] [ENSMUST00000139754] [ENSMUST00000144430]
Predicted Effect probably damaging
Transcript: ENSMUST00000024976
AA Change: L348Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160
AA Change: L348Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117890
AA Change: L313Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160
AA Change: L313Q

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119829
AA Change: L338Q

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160
AA Change: L338Q

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120943
AA Change: L313Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160
AA Change: L313Q

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121542
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect probably damaging
Transcript: ENSMUST00000168265
AA Change: L459Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160
AA Change: L459Q

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146923
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145882
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Spsb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Spsb3 APN 17 24890565 splice site probably benign
IGL03225:Spsb3 APN 17 24891071 missense possibly damaging 0.90
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0924:Spsb3 UTSW 17 24891384 missense probably damaging 0.98
R1291:Spsb3 UTSW 17 24887808 splice site probably null
R2211:Spsb3 UTSW 17 24890937 critical splice donor site probably null
R2378:Spsb3 UTSW 17 24886950 unclassified probably benign
R4512:Spsb3 UTSW 17 24890296 missense probably damaging 0.97
R4950:Spsb3 UTSW 17 24887511 intron probably benign
R5020:Spsb3 UTSW 17 24887062 unclassified probably benign
R5155:Spsb3 UTSW 17 24886995 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTCTACCCGATGGTTTGC -3'
(R):5'- GAAAAGCCTGGACCTCAGTTC -3'

Sequencing Primer
(F):5'- ATGGTTTGCTCCACGGC -3'
(R):5'- TCTCCTGCTGCCCTGGAAG -3'
Posted On2018-05-24