Incidental Mutation 'R6444:Olfr1475'
ID 519147
Institutional Source Beutler Lab
Gene Symbol Olfr1475
Ensembl Gene ENSMUSG00000096708
Gene Name olfactory receptor 1475
Synonyms GA_x6K02T2RE5P-3812807-3811863, MOR202-36
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R6444 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13479252-13480196 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13479430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 256 (M256K)
Ref Sequence ENSEMBL: ENSMUSP00000079616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080801]
AlphaFold Q8VEV6
Predicted Effect possibly damaging
Transcript: ENSMUST00000080801
AA Change: M256K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079616
Gene: ENSMUSG00000096708
AA Change: M256K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.7e-9 PFAM
Pfam:7tm_1 39 288 1.6e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Olfr1475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr1475 APN 19 13479787 missense possibly damaging 0.81
IGL01604:Olfr1475 APN 19 13479248 unclassified probably benign
IGL01656:Olfr1475 APN 19 13480090 missense probably benign 0.08
IGL01802:Olfr1475 APN 19 13479365 missense probably benign 0.05
IGL01839:Olfr1475 APN 19 13479440 missense probably benign
IGL02255:Olfr1475 APN 19 13479985 missense probably damaging 1.00
IGL02706:Olfr1475 APN 19 13480098 nonsense probably null
IGL02723:Olfr1475 APN 19 13479335 missense probably damaging 1.00
IGL03143:Olfr1475 APN 19 13479471 missense probably damaging 1.00
IGL03174:Olfr1475 APN 19 13480069 missense probably benign 0.10
BB007:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
BB017:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
R0442:Olfr1475 UTSW 19 13480048 missense probably damaging 1.00
R0490:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R0491:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R1757:Olfr1475 UTSW 19 13479607 missense possibly damaging 0.67
R1843:Olfr1475 UTSW 19 13479931 missense probably benign 0.00
R1972:Olfr1475 UTSW 19 13479694 missense probably benign 0.00
R2137:Olfr1475 UTSW 19 13479809 missense probably damaging 1.00
R3150:Olfr1475 UTSW 19 13479460 missense probably damaging 1.00
R3858:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3859:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3953:Olfr1475 UTSW 19 13479442 missense probably benign 0.43
R4611:Olfr1475 UTSW 19 13480012 missense probably damaging 0.96
R4934:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R5580:Olfr1475 UTSW 19 13479427 missense probably damaging 1.00
R6278:Olfr1475 UTSW 19 13479755 missense probably benign
R6796:Olfr1475 UTSW 19 13479914 missense probably damaging 1.00
R6812:Olfr1475 UTSW 19 13479611 missense probably benign 0.03
R7608:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R7632:Olfr1475 UTSW 19 13479431 missense possibly damaging 0.79
R7930:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
R8008:Olfr1475 UTSW 19 13479806 missense probably benign 0.01
R8416:Olfr1475 UTSW 19 13479400 missense possibly damaging 0.95
R8551:Olfr1475 UTSW 19 13479745 missense possibly damaging 0.88
R9058:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R9719:Olfr1475 UTSW 19 13480004 missense probably damaging 1.00
R9756:Olfr1475 UTSW 19 13479622 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAAGACTCAGTGTTTCATATGC -3'
(R):5'- TTACAGTCCTTATCTTGGGTACTTG -3'

Sequencing Primer
(F):5'- AAACTGTATACTACAGGGTTC -3'
(R):5'- AGTCCTTATCTTGGGTACTTGTGATG -3'
Posted On 2018-05-24