Mutagenetix > Incidental Mutations

Incidental Mutation 'R6445:Pms1'

519150

Institutional Source

Beutler Lab

Gene Symbol

Pms1

Ensembl Gene

ENSMUSG00000026098

Gene Name

PMS1 homolog 1, mismatch repair system component

Synonyms

MMRRC Submission

044388-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6445 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53189187-53297018 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53192194 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 832 (I832K)

Ref Sequence

ENSEMBL: ENSMUSP00000027267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000135246] [ENSMUST00000190748]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027267
AA Change: I832K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: I832K

Domain	Start	End	E-Value	Type
HATPase_c	16	151	3.84e-1	SMART
DNA_mis_repair	210	338	2.46e-25	SMART
low complexity region	457	474	N/A	INTRINSIC
HMG	557	627	1.42e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072235

SMART Domains

Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

Domain	Start	End	E-Value	Type
coiled coil region	38	68	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135246

SMART Domains

Protein: ENSMUSP00000119632
Gene: ENSMUSG00000026098

Domain	Start	End	E-Value	Type
HATPase_c	16	151	3.84e-1	SMART
DNA_mis_repair	210	338	2.46e-25	SMART
low complexity region	457	474	N/A	INTRINSIC
HMG	557	627	1.42e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190748

SMART Domains

Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

Domain	Start	End	E-Value	Type
coiled coil region	38	68	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191402

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC061237	C	A	14: 44,501,274	D43E	probably benign	Het
Cdh22	T	C	2: 165,170,692	I158V	probably damaging	Het
Cntrl	A	G	2: 35,162,848	I1676V	probably benign	Het
Crem	T	C	18: 3,309,671	Y18C	probably benign	Het
Cyp2b9	A	G	7: 26,186,987	I146V	probably benign	Het
Efcab14	C	A	4: 115,756,471	H205Q	possibly damaging	Het
Efcab6	T	C	15: 83,868,357	Y1437C	probably damaging	Het
Gm3055	T	A	10: 82,109,672	N375K	possibly damaging	Het
Gm36864	A	T	7: 44,237,418	Q245L	possibly damaging	Het
Gna11	A	T	10: 81,533,333	I132N	probably damaging	Het
Ikzf4	C	A	10: 128,636,555		probably null	Het
Il9r	C	T	11: 32,191,000	G346D	possibly damaging	Het
Krt71	C	T	15: 101,740,340	R190Q	probably benign	Het
Mfsd8	T	C	3: 40,837,118	I54V	probably damaging	Het
Nktr	G	T	9: 121,748,414		probably benign	Het
Olfr199	A	T	16: 59,216,109	F168Y	probably damaging	Het
Olfr562-ps1	T	C	7: 102,782,258	S261P	probably benign	Het
Peli2	T	C	14: 48,256,448	S376P	possibly damaging	Het
Pik3r2	C	T	8: 70,772,026	A202T	probably benign	Het
Reln	T	C	5: 21,919,214	K2765E	probably benign	Het
Rp1	A	T	1: 4,226,617	N744K	unknown	Het
Smcr8	T	C	11: 60,779,015	Y330H	possibly damaging	Het
Sned1	A	T	1: 93,283,596	R281S	possibly damaging	Het
Synm	A	G	7: 67,733,645	V1423A	probably benign	Het
Syt10	G	A	15: 89,814,268	T291I	probably damaging	Het
Ttn	T	C	2: 76,914,536		probably benign	Het
Wdr3	T	C	3: 100,156,403	T186A	possibly damaging	Het
Zfp451	A	C	1: 33,773,011	D874E	probably damaging	Het

Other mutations in Pms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Pms1	APN	1	53206556	splice site	probably benign
IGL00937:Pms1	APN	1	53275251	missense	possibly damaging	0.74
IGL01505:Pms1	APN	1	53206971	missense	probably benign
IGL02109:Pms1	APN	1	53207409	missense	probably damaging	0.96
IGL02245:Pms1	APN	1	53207360	missense	probably damaging	1.00
IGL02273:Pms1	APN	1	53207997	missense	probably damaging	1.00
IGL02339:Pms1	APN	1	53275165	missense	possibly damaging	0.78
R0157:Pms1	UTSW	1	53195037	nonsense	probably null
R0530:Pms1	UTSW	1	53196813	splice site	probably null
R1398:Pms1	UTSW	1	53207276	missense	possibly damaging	0.88
R1817:Pms1	UTSW	1	53206969	missense	probably benign	0.02
R1831:Pms1	UTSW	1	53207211	missense	probably benign	0.00
R1838:Pms1	UTSW	1	53192098	critical splice donor site	probably null
R1867:Pms1	UTSW	1	53189387	missense	probably benign	0.36
R1874:Pms1	UTSW	1	53207233	missense	probably benign	0.16
R1939:Pms1	UTSW	1	53196976	missense	probably damaging	1.00
R1991:Pms1	UTSW	1	53282042	missense	probably damaging	1.00
R1993:Pms1	UTSW	1	53195015	missense	probably benign
R1995:Pms1	UTSW	1	53195015	missense	probably benign
R2049:Pms1	UTSW	1	53281988	missense	probably damaging	0.99
R2058:Pms1	UTSW	1	53275168	missense	probably benign	0.00
R2140:Pms1	UTSW	1	53281988	missense	probably damaging	0.99
R4078:Pms1	UTSW	1	53267789	splice site	probably null
R4608:Pms1	UTSW	1	53194938	missense	possibly damaging	0.80
R4668:Pms1	UTSW	1	53189474	nonsense	probably null
R5164:Pms1	UTSW	1	53207640	missense	probably damaging	0.99
R5200:Pms1	UTSW	1	53206757	missense	probably benign	0.00
R5397:Pms1	UTSW	1	53192120	nonsense	probably null
R5745:Pms1	UTSW	1	53207702	nonsense	probably null
R6440:Pms1	UTSW	1	53195021	missense	probably damaging	0.98
R6802:Pms1	UTSW	1	53206792	missense	probably benign	0.06
R6975:Pms1	UTSW	1	53189431	missense	probably damaging	0.99
R7020:Pms1	UTSW	1	53189382	missense	probably damaging	1.00
R7037:Pms1	UTSW	1	53207611	missense	possibly damaging	0.95
R7199:Pms1	UTSW	1	53256730	missense	probably benign	0.02
R7417:Pms1	UTSW	1	53197072	missense	probably benign	0.00
R7587:Pms1	UTSW	1	53207316	missense	probably benign	0.00
R7716:Pms1	UTSW	1	53207608	missense	probably damaging	1.00
R8178:Pms1	UTSW	1	53207346	missense	probably benign	0.00
R8336:Pms1	UTSW	1	53206826	missense	probably benign
R8399:Pms1	UTSW	1	53267932	critical splice acceptor site	probably null
R8736:Pms1	UTSW	1	53267894	missense	possibly damaging	0.63
R8738:Pms1	UTSW	1	53282036	missense	possibly damaging	0.67
R8751:Pms1	UTSW	1	53192110	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCGCTCGCTCAGAAACTTC -3'
(R):5'- TCTGATGAAGGTTCACTAAGTGTTC -3'

Sequencing Primer
(F):5'- TGGTCCACAAAGTGAGTTCC -3'
(R):5'- GGTTCACTAAGTGTTCTAACAGTG -3'

Posted On

2018-05-24