Incidental Mutation 'R6445:Cdh22'
ID519154
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 044388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6445 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165170692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 158 (I158V)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: I158V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: I158V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
AA Change: I158V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: I158V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 C A 14: 44,501,274 D43E probably benign Het
Cntrl A G 2: 35,162,848 I1676V probably benign Het
Crem T C 18: 3,309,671 Y18C probably benign Het
Cyp2b9 A G 7: 26,186,987 I146V probably benign Het
Efcab14 C A 4: 115,756,471 H205Q possibly damaging Het
Efcab6 T C 15: 83,868,357 Y1437C probably damaging Het
Gm3055 T A 10: 82,109,672 N375K possibly damaging Het
Gm36864 A T 7: 44,237,418 Q245L possibly damaging Het
Gna11 A T 10: 81,533,333 I132N probably damaging Het
Ikzf4 C A 10: 128,636,555 probably null Het
Il9r C T 11: 32,191,000 G346D possibly damaging Het
Krt71 C T 15: 101,740,340 R190Q probably benign Het
Mfsd8 T C 3: 40,837,118 I54V probably damaging Het
Nktr G T 9: 121,748,414 probably benign Het
Olfr199 A T 16: 59,216,109 F168Y probably damaging Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Peli2 T C 14: 48,256,448 S376P possibly damaging Het
Pik3r2 C T 8: 70,772,026 A202T probably benign Het
Pms1 A T 1: 53,192,194 I832K possibly damaging Het
Reln T C 5: 21,919,214 K2765E probably benign Het
Rp1 A T 1: 4,226,617 N744K unknown Het
Smcr8 T C 11: 60,779,015 Y330H possibly damaging Het
Sned1 A T 1: 93,283,596 R281S possibly damaging Het
Synm A G 7: 67,733,645 V1423A probably benign Het
Syt10 G A 15: 89,814,268 T291I probably damaging Het
Ttn T C 2: 76,914,536 probably benign Het
Wdr3 T C 3: 100,156,403 T186A possibly damaging Het
Zfp451 A C 1: 33,773,011 D874E probably damaging Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
R8308:Cdh22 UTSW 2 165112178 missense probably damaging 0.99
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTAGCTACTCTGTCTTTCC -3'
(R):5'- ACTCGGATTCTGACGAAGGG -3'

Sequencing Primer
(F):5'- CTGCCCTTTCCATCAGGACG -3'
(R):5'- AAGTACACCATCTCGGGCGAG -3'
Posted On2018-05-24