Incidental Mutation 'R6445:Olfr562-ps1'
ID519162
Institutional Source Beutler Lab
Gene Symbol Olfr562-ps1
Ensembl Gene
Gene Nameolfactory receptor 562, pseudogene 1
SynonymsMOR14-5, GA_x6K02T2PBJ9-5498153-5499103
MMRRC Submission 044388-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6445 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102781478-102782428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102782258 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 261 (S261P)
Ref Sequence ENSEMBL: ENSMUSP00000148106 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000210779
AA Change: S261P

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 C A 14: 44,501,274 D43E probably benign Het
Cdh22 T C 2: 165,170,692 I158V probably damaging Het
Cntrl A G 2: 35,162,848 I1676V probably benign Het
Crem T C 18: 3,309,671 Y18C probably benign Het
Cyp2b9 A G 7: 26,186,987 I146V probably benign Het
Efcab14 C A 4: 115,756,471 H205Q possibly damaging Het
Efcab6 T C 15: 83,868,357 Y1437C probably damaging Het
Gm3055 T A 10: 82,109,672 N375K possibly damaging Het
Gm36864 A T 7: 44,237,418 Q245L possibly damaging Het
Gna11 A T 10: 81,533,333 I132N probably damaging Het
Ikzf4 C A 10: 128,636,555 probably null Het
Il9r C T 11: 32,191,000 G346D possibly damaging Het
Krt71 C T 15: 101,740,340 R190Q probably benign Het
Mfsd8 T C 3: 40,837,118 I54V probably damaging Het
Nktr G T 9: 121,748,414 probably benign Het
Olfr199 A T 16: 59,216,109 F168Y probably damaging Het
Peli2 T C 14: 48,256,448 S376P possibly damaging Het
Pik3r2 C T 8: 70,772,026 A202T probably benign Het
Pms1 A T 1: 53,192,194 I832K possibly damaging Het
Reln T C 5: 21,919,214 K2765E probably benign Het
Rp1 A T 1: 4,226,617 N744K unknown Het
Smcr8 T C 11: 60,779,015 Y330H possibly damaging Het
Sned1 A T 1: 93,283,596 R281S possibly damaging Het
Synm A G 7: 67,733,645 V1423A probably benign Het
Syt10 G A 15: 89,814,268 T291I probably damaging Het
Ttn T C 2: 76,914,536 probably benign Het
Wdr3 T C 3: 100,156,403 T186A possibly damaging Het
Zfp451 A C 1: 33,773,011 D874E probably damaging Het
Other mutations in Olfr562-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4151001:Olfr562-ps1 UTSW 7 102782258 missense probably benign 0.36
R6493:Olfr562-ps1 UTSW 7 102782396 missense probably benign 0.29
R6615:Olfr562-ps1 UTSW 7 102781787 missense probably damaging 1.00
R7608:Olfr562-ps1 UTSW 7 102781925 missense probably benign 0.01
R7744:Olfr562-ps1 UTSW 7 102782390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGTGCAGTTGGGCTCAC -3'
(R):5'- TCCTCTTCCATAAAGTGCCAAAG -3'

Sequencing Primer
(F):5'- ACTGCCCTGATCTCCACTG -3'
(R):5'- AAAACAACCATCTAGCTCTTTGTC -3'
Posted On2018-05-24