Incidental Mutation 'R6445:Olfr199'
ID519175
Institutional Source Beutler Lab
Gene Symbol Olfr199
Ensembl Gene ENSMUSG00000074996
Gene Nameolfactory receptor 199
SynonymsGA_x54KRFPKG5P-55430495-55429569, MOR182-14
MMRRC Submission 044388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6445 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59214134-59219767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59216109 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 168 (F168Y)
Ref Sequence ENSEMBL: ENSMUSP00000150643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099657] [ENSMUST00000214186]
Predicted Effect probably damaging
Transcript: ENSMUST00000099657
AA Change: F168Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097249
Gene: ENSMUSG00000074996
AA Change: F168Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.6e-6 PFAM
Pfam:7tm_1 41 290 4.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214186
AA Change: F168Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 C A 14: 44,501,274 D43E probably benign Het
Cdh22 T C 2: 165,170,692 I158V probably damaging Het
Cntrl A G 2: 35,162,848 I1676V probably benign Het
Crem T C 18: 3,309,671 Y18C probably benign Het
Cyp2b9 A G 7: 26,186,987 I146V probably benign Het
Efcab14 C A 4: 115,756,471 H205Q possibly damaging Het
Efcab6 T C 15: 83,868,357 Y1437C probably damaging Het
Gm3055 T A 10: 82,109,672 N375K possibly damaging Het
Gm36864 A T 7: 44,237,418 Q245L possibly damaging Het
Gna11 A T 10: 81,533,333 I132N probably damaging Het
Ikzf4 C A 10: 128,636,555 probably null Het
Il9r C T 11: 32,191,000 G346D possibly damaging Het
Krt71 C T 15: 101,740,340 R190Q probably benign Het
Mfsd8 T C 3: 40,837,118 I54V probably damaging Het
Nktr G T 9: 121,748,414 probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Peli2 T C 14: 48,256,448 S376P possibly damaging Het
Pik3r2 C T 8: 70,772,026 A202T probably benign Het
Pms1 A T 1: 53,192,194 I832K possibly damaging Het
Reln T C 5: 21,919,214 K2765E probably benign Het
Rp1 A T 1: 4,226,617 N744K unknown Het
Smcr8 T C 11: 60,779,015 Y330H possibly damaging Het
Sned1 A T 1: 93,283,596 R281S possibly damaging Het
Synm A G 7: 67,733,645 V1423A probably benign Het
Syt10 G A 15: 89,814,268 T291I probably damaging Het
Ttn T C 2: 76,914,536 probably benign Het
Wdr3 T C 3: 100,156,403 T186A possibly damaging Het
Zfp451 A C 1: 33,773,011 D874E probably damaging Het
Other mutations in Olfr199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr199 APN 16 59216496 missense probably damaging 0.97
IGL00972:Olfr199 APN 16 59216466 missense probably damaging 1.00
IGL01734:Olfr199 APN 16 59216429 missense probably benign 0.12
IGL01876:Olfr199 APN 16 59216019 missense possibly damaging 0.89
IGL02017:Olfr199 APN 16 59215947 missense probably damaging 1.00
IGL02871:Olfr199 APN 16 59216374 nonsense probably null
IGL03153:Olfr199 APN 16 59216203 missense probably benign 0.35
R0702:Olfr199 UTSW 16 59215699 missense probably benign
R0825:Olfr199 UTSW 16 59216450 missense possibly damaging 0.70
R1522:Olfr199 UTSW 16 59215984 missense probably damaging 1.00
R1769:Olfr199 UTSW 16 59215981 missense probably benign 0.01
R2144:Olfr199 UTSW 16 59216026 missense probably benign 0.00
R3956:Olfr199 UTSW 16 59216065 nonsense probably null
R4783:Olfr199 UTSW 16 59215859 missense probably damaging 0.98
R5534:Olfr199 UTSW 16 59216040 missense probably benign 0.39
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6141:Olfr199 UTSW 16 59216553 missense probably benign
R6459:Olfr199 UTSW 16 59216020 missense probably benign 0.44
R6568:Olfr199 UTSW 16 59216278 missense probably benign 0.36
R7378:Olfr199 UTSW 16 59215920 missense probably benign 0.00
R7438:Olfr199 UTSW 16 59216398 missense probably benign 0.10
R8157:Olfr199 UTSW 16 59215989 missense probably benign
R8258:Olfr199 UTSW 16 59216095 missense probably benign 0.00
R8259:Olfr199 UTSW 16 59216095 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAAGGCTTTGCTTCTGCC -3'
(R):5'- TTCCAGTGCAACCACGGAATG -3'

Sequencing Primer
(F):5'- GACTTCTTTCTCAGGATGGCAAAGAG -3'
(R):5'- GTGCAACCACGGAATGCTTTC -3'
Posted On2018-05-24