Mutagenetix > Incidental Mutation

Incidental Mutation 'R6446:Grid2'

519188

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

044583-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6446 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64322577 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 526 (I526F)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably damaging
Transcript: ENSMUST00000095852
AA Change: I526F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I526F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Meta Mutation Damage Score

0.7603

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp13a3	A	G	16: 30,180,687 (GRCm39)	L114P	probably benign	Het
Blm	GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC	GCCTCCTCCTCCTCCTCCTCCTCCTCC	7: 80,162,652 (GRCm39)		probably benign	Het
Catsperg1	T	C	7: 28,905,992 (GRCm39)	I196V	probably benign	Het
Cbx2	T	A	11: 118,918,752 (GRCm39)	S106T	probably benign	Het
Ccar2	T	A	14: 70,380,518 (GRCm39)	E354V	probably benign	Het
Ccr1	A	G	9: 123,764,143 (GRCm39)	I129T	probably damaging	Het
Cdkl2	T	A	5: 92,181,076 (GRCm39)	I188F	probably damaging	Het
Cep350	T	C	1: 155,737,900 (GRCm39)	N2648D	probably benign	Het
Chtf18	A	G	17: 25,940,218 (GRCm39)	S658P	probably benign	Het
Csnka2ip	G	A	16: 64,299,744 (GRCm39)	Q207*	probably null	Het
Dennd5a	A	G	7: 109,493,873 (GRCm39)	L1253P	probably damaging	Het
Dennd6a	T	A	14: 26,350,689 (GRCm39)	I374K	probably damaging	Het
Dut	T	C	2: 125,092,939 (GRCm39)		probably null	Het
Gcm1	T	C	9: 77,967,065 (GRCm39)	Y95H	probably benign	Het
Hectd4	T	A	5: 121,472,438 (GRCm39)	Y2725N	possibly damaging	Het
Helq	A	T	5: 100,916,250 (GRCm39)	N907K	possibly damaging	Het
Hpse	G	A	5: 100,843,435 (GRCm39)	Q246*	probably null	Het
Iigp1c	A	G	18: 60,378,840 (GRCm39)	D125G	probably damaging	Het
Kcnj15	C	T	16: 95,097,118 (GRCm39)	H247Y	probably benign	Het
Kif27	C	A	13: 58,493,530 (GRCm39)	V138F	probably damaging	Het
Map7	T	G	10: 20,153,979 (GRCm39)	D698E	unknown	Het
Mtmr11	A	T	3: 96,078,504 (GRCm39)	S687C	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,775,161 (GRCm39)		probably null	Het
Nup210l	G	A	3: 90,079,375 (GRCm39)	G953E	probably damaging	Het
Or14c45	T	A	7: 86,176,310 (GRCm39)	I115N	possibly damaging	Het
Piezo2	G	T	18: 63,219,678 (GRCm39)	P792T	probably damaging	Het
Pld3	T	C	7: 27,237,156 (GRCm39)	D241G	probably damaging	Het
Prss35	G	T	9: 86,637,706 (GRCm39)	V159F	probably damaging	Het
Rimbp3	A	T	16: 17,030,793 (GRCm39)	M1406L	probably benign	Het
Serpina3g	T	C	12: 104,205,341 (GRCm39)	F27L	probably damaging	Het
Setd1b	G	A	5: 123,299,862 (GRCm39)		probably benign	Het
Sh3glb1	T	C	3: 144,411,366 (GRCm39)	K13E	probably damaging	Het
Slc29a1	A	T	17: 45,900,171 (GRCm39)	I217N	possibly damaging	Het
Spag17	A	T	3: 100,010,448 (GRCm39)	T1981S	probably benign	Het
Svil	A	C	18: 5,057,323 (GRCm39)	E590D	probably benign	Het
Synm	A	G	7: 67,384,714 (GRCm39)	S541P	probably damaging	Het
Vmn2r108	A	T	17: 20,692,609 (GRCm39)	Y82*	probably null	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64,322,718 (GRCm39)	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64,642,982 (GRCm39)	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63,907,894 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5626:Grid2	UTSW	6	64,053,929 (GRCm39)	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64,372,283 (GRCm39)	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGAAGTCCCTGCAGTACTTTCAG -3'
(R):5'- TCCCATTTGCAATCGTGGGG -3'

Sequencing Primer
(F):5'- TTTTCTCCCCCAAGGCAA -3'
(R):5'- TTAAGCCAGTTTAAGAGGTAGACC -3'

Posted On

2018-05-24