Incidental Mutation 'R6447:Hdac2'
ID519232
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission 044389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6447 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36993816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000101149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019911
AA Change: V258A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: V258A

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105510
AA Change: V258A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: V258A

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128031
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Axl C A 7: 25,770,283 R476I probably damaging Het
Casr A G 16: 36,495,545 L721P probably damaging Het
Cntn6 A T 6: 104,859,448 H925L probably damaging Het
Csmd1 T C 8: 15,910,527 Y3296C probably damaging Het
Dnah3 G A 7: 119,923,054 T3972M probably benign Het
Ect2 A G 3: 27,115,484 F740S probably damaging Het
Exoc1 T A 5: 76,543,517 D222E probably damaging Het
Gm8298 A G 3: 59,865,398 I108V probably damaging Het
Gm8332 T C 12: 88,249,724 D126G unknown Het
Lrrk1 A G 7: 66,302,728 S487P probably benign Het
Lyplal1 A T 1: 186,089,442 probably null Het
Nwd2 T A 5: 63,807,555 I1494N probably benign Het
Pcdhb22 A G 18: 37,520,216 E579G possibly damaging Het
Samd8 T C 14: 21,792,556 probably null Het
Sccpdh A G 1: 179,678,888 *131W probably null Het
Smarcal1 C T 1: 72,585,874 S60L probably damaging Het
Stau2 A T 1: 16,389,825 V264E possibly damaging Het
T T C 17: 8,441,631 I217T possibly damaging Het
Tbc1d1 C T 5: 64,333,493 L896F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmprss11f T C 5: 86,528,227 Y365C probably damaging Het
Trdv4 A G 14: 54,075,474 T102A probably damaging Het
Vmn1r205 G T 13: 22,592,742 N63K probably damaging Het
Vps13b T C 15: 35,572,126 V963A probably benign Het
Zswim2 T C 2: 83,915,113 probably null Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0455:Hdac2 UTSW 10 36991836 missense probably damaging 1.00
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1101:Hdac2 UTSW 10 36991809 missense probably damaging 1.00
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6109:Hdac2 UTSW 10 36986389 missense probably null 0.83
R6519:Hdac2 UTSW 10 36989256 missense probably damaging 1.00
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCAATTTTCCCATGAGAGATG -3'
(R):5'- GTACCACATGCATGCAAATCAG -3'

Sequencing Primer
(F):5'- GCCTGTAAGTACTGCTTTCA -3'
(R):5'- TTTTGAGCCAACATGTAGGAGC -3'
Posted On2018-05-24