Incidental Mutation 'R6448:Kif14'
ID519241
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R6448 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136503347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1161 (V1161F)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
PDB Structure
Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000047817
AA Change: V1111F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: V1111F

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088648
Predicted Effect probably damaging
Transcript: ENSMUST00000189413
AA Change: V1161F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: V1161F

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Meta Mutation Damage Score 0.0208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 A T 12: 52,517,663 K472N probably benign Het
C2 T G 17: 34,863,359 D298A possibly damaging Het
Col16a1 T G 4: 130,058,988 L409R probably damaging Het
Dlgap1 A G 17: 70,593,330 E380G possibly damaging Het
Fam111a C A 19: 12,588,337 H483Q probably benign Het
Fancc C T 13: 63,340,428 R246Q probably damaging Het
Glb1 A T 9: 114,434,431 Q256L probably damaging Het
Gm9195 A T 14: 72,434,011 D2611E possibly damaging Het
Gsto1 C T 19: 47,857,981 T89I probably benign Het
Hmcn2 A G 2: 31,420,820 S3359G probably benign Het
Hook3 T A 8: 26,093,664 N87I probably benign Het
Htt T A 5: 34,875,992 M1868K probably benign Het
Ighv1-19 T C 12: 114,708,676 E107G probably damaging Het
Il20rb A T 9: 100,474,933 M48K probably benign Het
Inpp5j T C 11: 3,495,387 H822R probably damaging Het
Klhdc2 T A 12: 69,303,920 D169E probably benign Het
Ly75 A G 2: 60,299,045 probably null Het
Myh15 T G 16: 49,171,932 S1590A probably damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Neb T C 2: 52,148,814 D6748G probably damaging Het
Nfrkb T C 9: 31,394,789 Y142H probably damaging Het
Olfr1051 T A 2: 86,276,347 I47F probably benign Het
Olfr1355 G A 10: 78,879,682 C170Y possibly damaging Het
Olfr784 A T 10: 129,388,152 D173V probably damaging Het
Prm2 G A 16: 10,791,961 probably benign Het
Ralgapa1 T C 12: 55,719,661 T1283A probably benign Het
Rest T C 5: 77,281,471 L579P possibly damaging Het
Slc6a1 C T 6: 114,302,086 T46I possibly damaging Het
Tcf20 A G 15: 82,852,660 I1530T probably benign Het
Tox T G 4: 6,822,975 D114A probably benign Het
Ulk4 C T 9: 121,103,630 G1048D probably damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATTCCATGTTATTCCATGTT -3'
(R):5'- CTTTTGGGAGGAGCAGAGAGC -3'

Sequencing Primer
(F):5'- CCCTTGAACTGGAGTTACAGG -3'
(R):5'- CTGTGATCATAGGCATGCATGACC -3'
Posted On2018-05-24