Incidental Mutation 'R6448:Ighv1-19'
ID519262
Institutional Source Beutler Lab
Gene Symbol Ighv1-19
Ensembl Gene ENSMUSG00000096410
Gene Nameimmunoglobulin heavy variable V1-19
SynonymsGm16855
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6448 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location114708648-114709135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114708676 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 107 (E107G)
Ref Sequence ENSEMBL: ENSMUSP00000100286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103505] [ENSMUST00000193855]
Predicted Effect probably damaging
Transcript: ENSMUST00000103505
AA Change: E107G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100286
Gene: ENSMUSG00000096410
AA Change: E107G

DomainStartEndE-ValueType
IGv 35 116 8.41e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192823
Predicted Effect probably damaging
Transcript: ENSMUST00000193855
AA Change: E108G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141737
Gene: ENSMUSG00000096410
AA Change: E108G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.5e-31 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 A T 12: 52,517,663 K472N probably benign Het
C2 T G 17: 34,863,359 D298A possibly damaging Het
Col16a1 T G 4: 130,058,988 L409R probably damaging Het
Dlgap1 A G 17: 70,593,330 E380G possibly damaging Het
Fam111a C A 19: 12,588,337 H483Q probably benign Het
Fancc C T 13: 63,340,428 R246Q probably damaging Het
Glb1 A T 9: 114,434,431 Q256L probably damaging Het
Gm9195 A T 14: 72,434,011 D2611E possibly damaging Het
Gsto1 C T 19: 47,857,981 T89I probably benign Het
Hmcn2 A G 2: 31,420,820 S3359G probably benign Het
Hook3 T A 8: 26,093,664 N87I probably benign Het
Htt T A 5: 34,875,992 M1868K probably benign Het
Il20rb A T 9: 100,474,933 M48K probably benign Het
Inpp5j T C 11: 3,495,387 H822R probably damaging Het
Kif14 G T 1: 136,503,347 V1161F probably damaging Het
Klhdc2 T A 12: 69,303,920 D169E probably benign Het
Ly75 A G 2: 60,299,045 probably null Het
Myh15 T G 16: 49,171,932 S1590A probably damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Neb T C 2: 52,148,814 D6748G probably damaging Het
Nfrkb T C 9: 31,394,789 Y142H probably damaging Het
Olfr1051 T A 2: 86,276,347 I47F probably benign Het
Olfr1355 G A 10: 78,879,682 C170Y possibly damaging Het
Olfr784 A T 10: 129,388,152 D173V probably damaging Het
Prm2 G A 16: 10,791,961 probably benign Het
Ralgapa1 T C 12: 55,719,661 T1283A probably benign Het
Rest T C 5: 77,281,471 L579P possibly damaging Het
Slc6a1 C T 6: 114,302,086 T46I possibly damaging Het
Tcf20 A G 15: 82,852,660 I1530T probably benign Het
Tox T G 4: 6,822,975 D114A probably benign Het
Ulk4 C T 9: 121,103,630 G1048D probably damaging Het
Other mutations in Ighv1-19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ighv1-19 APN 12 114708709 missense probably benign 0.15
IGL00966:Ighv1-19 APN 12 114708949 missense possibly damaging 0.51
IGL02545:Ighv1-19 APN 12 114708739 missense probably damaging 1.00
R3729:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3730:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3731:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R4093:Ighv1-19 UTSW 12 114708730 missense probably damaging 1.00
R4969:Ighv1-19 UTSW 12 114708757 missense probably benign 0.12
R5021:Ighv1-19 UTSW 12 114709066 missense probably benign 0.00
R7335:Ighv1-19 UTSW 12 114708951 critical splice acceptor site probably benign
R8364:Ighv1-19 UTSW 12 114708926 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATGGATGGCCTTGTGCAAAG -3'
(R):5'- TCTGGATACACATTCACTGACTAC -3'

Sequencing Primer
(F):5'- TCTCTAAGCCTTGTCAGTC -3'
(R):5'- CACTGACTACTATATGAACTGGGTG -3'
Posted On2018-05-24