Incidental Mutation 'R6448:Prm2'
ID519266
Institutional Source Beutler Lab
Gene Symbol Prm2
Ensembl Gene ENSMUSG00000038015
Gene Nameprotamine 2
SynonymsPrm-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6448 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location10791380-10796134 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 10791961 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023144] [ENSMUST00000037996] [ENSMUST00000050864] [ENSMUST00000051297] [ENSMUST00000189593] [ENSMUST00000230568]
Predicted Effect probably benign
Transcript: ENSMUST00000023144
SMART Domains Protein: ENSMUSP00000023144
Gene: ENSMUSG00000022501

DomainStartEndE-ValueType
Pfam:Protamine_P1 2 50 1e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000037996
AA Change: P13L
SMART Domains Protein: ENSMUSP00000047925
Gene: ENSMUSG00000038015
AA Change: P13L

DomainStartEndE-ValueType
Pfam:Protamine_P2 1 90 7.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050864
SMART Domains Protein: ENSMUSP00000059630
Gene: ENSMUSG00000050058

DomainStartEndE-ValueType
coiled coil region 41 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051297
SMART Domains Protein: ENSMUSP00000053078
Gene: ENSMUSG00000043050

DomainStartEndE-ValueType
Pfam:TP2 1 117 4.1e-40 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189593
AA Change: P13L
SMART Domains Protein: ENSMUSP00000139898
Gene: ENSMUSG00000038015
AA Change: P13L

DomainStartEndE-ValueType
Pfam:Protamine_P2 1 91 1.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230568
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis, and are the major DNA-binding proteins in the nucleus of sperm in many vertebrates. They package the sperm DNA into a highly condensed complex in a volume less than 5% of a somatic cell nucleus. Many mammalian species have only one protamine (protamine 1); however, a few species, including human and mouse, have two. This gene encodes protamine 2, which is synthesized as a precursor and then cleaved to give rise to a family of protamine 2 peptides. [provided by RefSeq, Sep 2015]
PHENOTYPE: In chimeras deformed sperm with loosely compacted chromatin are derived from spermatogenic cells with one copy of the mutated allele. No offspring carrying the mutated allele are produced from matings using chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 A T 12: 52,517,663 K472N probably benign Het
C2 T G 17: 34,863,359 D298A possibly damaging Het
Col16a1 T G 4: 130,058,988 L409R probably damaging Het
Dlgap1 A G 17: 70,593,330 E380G possibly damaging Het
Fam111a C A 19: 12,588,337 H483Q probably benign Het
Fancc C T 13: 63,340,428 R246Q probably damaging Het
Glb1 A T 9: 114,434,431 Q256L probably damaging Het
Gm9195 A T 14: 72,434,011 D2611E possibly damaging Het
Gsto1 C T 19: 47,857,981 T89I probably benign Het
Hmcn2 A G 2: 31,420,820 S3359G probably benign Het
Hook3 T A 8: 26,093,664 N87I probably benign Het
Htt T A 5: 34,875,992 M1868K probably benign Het
Ighv1-19 T C 12: 114,708,676 E107G probably damaging Het
Il20rb A T 9: 100,474,933 M48K probably benign Het
Inpp5j T C 11: 3,495,387 H822R probably damaging Het
Kif14 G T 1: 136,503,347 V1161F probably damaging Het
Klhdc2 T A 12: 69,303,920 D169E probably benign Het
Ly75 A G 2: 60,299,045 probably null Het
Myh15 T G 16: 49,171,932 S1590A probably damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Neb T C 2: 52,148,814 D6748G probably damaging Het
Nfrkb T C 9: 31,394,789 Y142H probably damaging Het
Olfr1051 T A 2: 86,276,347 I47F probably benign Het
Olfr1355 G A 10: 78,879,682 C170Y possibly damaging Het
Olfr784 A T 10: 129,388,152 D173V probably damaging Het
Ralgapa1 T C 12: 55,719,661 T1283A probably benign Het
Rest T C 5: 77,281,471 L579P possibly damaging Het
Slc6a1 C T 6: 114,302,086 T46I possibly damaging Het
Tcf20 A G 15: 82,852,660 I1530T probably benign Het
Tox T G 4: 6,822,975 D114A probably benign Het
Ulk4 C T 9: 121,103,630 G1048D probably damaging Het
Other mutations in Prm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01837:Prm2 APN 16 10791911 unclassified probably null
IGL01838:Prm2 APN 16 10791808 unclassified probably benign
IGL02414:Prm2 APN 16 10791890 unclassified probably benign
R0212:Prm2 UTSW 16 10791599 unclassified probably benign
R1848:Prm2 UTSW 16 10791591 unclassified probably benign
R4604:Prm2 UTSW 16 10791749 unclassified probably benign
R5144:Prm2 UTSW 16 10791868 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTTAGATGGGCAGCAGCAG -3'
(R):5'- ATATGAGCCCTCTGAGAGCC -3'

Sequencing Primer
(F):5'- GGTGCTTACCTCTGCGATGC -3'
(R):5'- GCCCTCTGAGAGCCCCAAAC -3'
Posted On2018-05-24