Incidental Mutation 'R6449:Gm5592'
ID519292
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6449 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41288586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 431 (V431I)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably benign
Transcript: ENSMUST00000097044
AA Change: V431I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: V431I

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
AA Change: V431I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
Adam28 T C 14: 68,630,667 T410A probably benign Het
Ano10 T C 9: 122,201,688 probably benign Het
Bmpr2 T A 1: 59,867,437 V563E probably damaging Het
Ccdc47 A G 11: 106,204,985 L295P probably damaging Het
Cdhr1 T C 14: 37,090,597 T210A probably benign Het
Col16a1 G A 4: 130,066,693 A408T unknown Het
Csnk1g2 A G 10: 80,640,072 K415R probably damaging Het
Cyp2c29 G T 19: 39,290,867 A103S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A T 18: 20,394,441 I210F possibly damaging Het
Fhod1 T A 8: 105,330,237 D1002V probably damaging Het
Gm5538 A T 3: 59,745,551 D137V probably damaging Het
Gtpbp4 A T 13: 8,990,737 C174* probably null Het
Il2ra A G 2: 11,680,362 K170E probably benign Het
Itch T C 2: 155,163,395 probably benign Het
Jazf1 A C 6: 52,777,655 D145E probably damaging Het
Kank2 G T 9: 21,780,562 A469E possibly damaging Het
Kirrel3 A G 9: 34,990,973 I125V probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap27-1 C T 16: 88,671,053 S201N probably benign Het
Map3k20 T C 2: 72,398,414 S326P probably damaging Het
Mkks C A 2: 136,874,286 V565F probably damaging Het
Olfr1131 T C 2: 87,629,149 S229P possibly damaging Het
Olfr175-ps1 A T 16: 58,824,526 I61N probably damaging Het
Olfr368 A G 2: 37,331,825 D26G possibly damaging Het
Pacsin3 A T 2: 91,260,169 probably null Het
Pdcd7 A G 9: 65,356,775 E434G probably damaging Het
Plekhb2 T C 1: 34,864,483 F102L probably benign Het
Ppp1r9a A G 6: 5,057,458 D191G probably benign Het
Psmd3 A G 11: 98,685,640 T123A probably benign Het
Ptprq C T 10: 107,705,583 V361M probably benign Het
Raver2 A G 4: 101,133,672 D414G probably benign Het
Rnf123 G A 9: 108,056,053 H1162Y probably benign Het
Sema4f A G 6: 82,917,870 V448A probably benign Het
Tcf12 A T 9: 71,868,268 M400K probably damaging Het
Tcl1b2 G T 12: 105,153,002 E50* probably null Het
Thada A C 17: 84,429,173 D893E probably benign Het
Trim24 G A 6: 37,903,652 probably null Het
Ttll5 T C 12: 86,024,276 S1308P probably benign Het
Ubtfl1 T A 9: 18,409,629 I151N possibly damaging Het
Vmn2r70 A T 7: 85,564,949 F332I probably damaging Het
Wdyhv1 T G 15: 58,150,598 probably null Het
Zfhx4 A G 3: 5,242,428 D238G probably damaging Het
Zfp639 A G 3: 32,519,661 H145R possibly damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGATTCTGATAATGCCC -3'
(R):5'- GGATTTGTTCTGTGGCCCAC -3'

Sequencing Primer
(F):5'- AGCCTGATTCTGATAATGCCCATTTG -3'
(R):5'- TTCTTGCTGGGAGGCCC -3'
Posted On2018-05-24