Incidental Mutation 'R6449:Ano10'
ID519302
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6449 (G1)
Quality Score125.008
Status Validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 122201688 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081]
Predicted Effect probably benign
Transcript: ENSMUST00000042546
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214283
Predicted Effect probably benign
Transcript: ENSMUST00000214409
Predicted Effect unknown
Transcript: ENSMUST00000214507
AA Change: D474G
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
Adam28 T C 14: 68,630,667 T410A probably benign Het
Bmpr2 T A 1: 59,867,437 V563E probably damaging Het
Ccdc47 A G 11: 106,204,985 L295P probably damaging Het
Cdhr1 T C 14: 37,090,597 T210A probably benign Het
Col16a1 G A 4: 130,066,693 A408T unknown Het
Csnk1g2 A G 10: 80,640,072 K415R probably damaging Het
Cyp2c29 G T 19: 39,290,867 A103S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A T 18: 20,394,441 I210F possibly damaging Het
Fhod1 T A 8: 105,330,237 D1002V probably damaging Het
Gm5538 A T 3: 59,745,551 D137V probably damaging Het
Gm5592 G A 7: 41,288,586 V431I probably benign Het
Gtpbp4 A T 13: 8,990,737 C174* probably null Het
Il2ra A G 2: 11,680,362 K170E probably benign Het
Itch T C 2: 155,163,395 probably benign Het
Jazf1 A C 6: 52,777,655 D145E probably damaging Het
Kank2 G T 9: 21,780,562 A469E possibly damaging Het
Kirrel3 A G 9: 34,990,973 I125V probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap27-1 C T 16: 88,671,053 S201N probably benign Het
Map3k20 T C 2: 72,398,414 S326P probably damaging Het
Mkks C A 2: 136,874,286 V565F probably damaging Het
Olfr1131 T C 2: 87,629,149 S229P possibly damaging Het
Olfr175-ps1 A T 16: 58,824,526 I61N probably damaging Het
Olfr368 A G 2: 37,331,825 D26G possibly damaging Het
Pacsin3 A T 2: 91,260,169 probably null Het
Pdcd7 A G 9: 65,356,775 E434G probably damaging Het
Plekhb2 T C 1: 34,864,483 F102L probably benign Het
Ppp1r9a A G 6: 5,057,458 D191G probably benign Het
Psmd3 A G 11: 98,685,640 T123A probably benign Het
Ptprq C T 10: 107,705,583 V361M probably benign Het
Raver2 A G 4: 101,133,672 D414G probably benign Het
Rnf123 G A 9: 108,056,053 H1162Y probably benign Het
Sema4f A G 6: 82,917,870 V448A probably benign Het
Tcf12 A T 9: 71,868,268 M400K probably damaging Het
Tcl1b2 G T 12: 105,153,002 E50* probably null Het
Thada A C 17: 84,429,173 D893E probably benign Het
Trim24 G A 6: 37,903,652 probably null Het
Ttll5 T C 12: 86,024,276 S1308P probably benign Het
Ubtfl1 T A 9: 18,409,629 I151N possibly damaging Het
Vmn2r70 A T 7: 85,564,949 F332I probably damaging Het
Wdyhv1 T G 15: 58,150,598 probably null Het
Zfhx4 A G 3: 5,242,428 D238G probably damaging Het
Zfp639 A G 3: 32,519,661 H145R possibly damaging Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R1801:Ano10 UTSW 9 122253030 missense probably damaging 1.00
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4027:Ano10 UTSW 9 122252928 splice site probably benign
R4151:Ano10 UTSW 9 122261535 nonsense probably null
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R4676:Ano10 UTSW 9 122263787 missense probably damaging 0.98
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7010:Ano10 UTSW 9 122253124 missense probably damaging 1.00
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAATCCTGCTCACTGG -3'
(R):5'- TGGCTCTGAAGTTCATACTCGC -3'

Sequencing Primer
(F):5'- CCCAGTGCTTCTATATAAGGCATGG -3'
(R):5'- GGCTCTGAAGTTCATACTCGCATTTG -3'
Posted On2018-05-24