Incidental Mutation 'R6449:Adam28'
ID519311
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6449 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68630667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 410 (T410A)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: T410A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: T410A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: T410A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: T410A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: T410A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.4092 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
Ano10 T C 9: 122,201,688 probably benign Het
Bmpr2 T A 1: 59,867,437 V563E probably damaging Het
Ccdc47 A G 11: 106,204,985 L295P probably damaging Het
Cdhr1 T C 14: 37,090,597 T210A probably benign Het
Col16a1 G A 4: 130,066,693 A408T unknown Het
Csnk1g2 A G 10: 80,640,072 K415R probably damaging Het
Cyp2c29 G T 19: 39,290,867 A103S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A T 18: 20,394,441 I210F possibly damaging Het
Fhod1 T A 8: 105,330,237 D1002V probably damaging Het
Gm5538 A T 3: 59,745,551 D137V probably damaging Het
Gm5592 G A 7: 41,288,586 V431I probably benign Het
Gtpbp4 A T 13: 8,990,737 C174* probably null Het
Il2ra A G 2: 11,680,362 K170E probably benign Het
Itch T C 2: 155,163,395 probably benign Het
Jazf1 A C 6: 52,777,655 D145E probably damaging Het
Kank2 G T 9: 21,780,562 A469E possibly damaging Het
Kirrel3 A G 9: 34,990,973 I125V probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap27-1 C T 16: 88,671,053 S201N probably benign Het
Map3k20 T C 2: 72,398,414 S326P probably damaging Het
Mkks C A 2: 136,874,286 V565F probably damaging Het
Olfr1131 T C 2: 87,629,149 S229P possibly damaging Het
Olfr175-ps1 A T 16: 58,824,526 I61N probably damaging Het
Olfr368 A G 2: 37,331,825 D26G possibly damaging Het
Pacsin3 A T 2: 91,260,169 probably null Het
Pdcd7 A G 9: 65,356,775 E434G probably damaging Het
Plekhb2 T C 1: 34,864,483 F102L probably benign Het
Ppp1r9a A G 6: 5,057,458 D191G probably benign Het
Psmd3 A G 11: 98,685,640 T123A probably benign Het
Ptprq C T 10: 107,705,583 V361M probably benign Het
Raver2 A G 4: 101,133,672 D414G probably benign Het
Rnf123 G A 9: 108,056,053 H1162Y probably benign Het
Sema4f A G 6: 82,917,870 V448A probably benign Het
Tcf12 A T 9: 71,868,268 M400K probably damaging Het
Tcl1b2 G T 12: 105,153,002 E50* probably null Het
Thada A C 17: 84,429,173 D893E probably benign Het
Trim24 G A 6: 37,903,652 probably null Het
Ttll5 T C 12: 86,024,276 S1308P probably benign Het
Ubtfl1 T A 9: 18,409,629 I151N possibly damaging Het
Vmn2r70 A T 7: 85,564,949 F332I probably damaging Het
Wdyhv1 T G 15: 58,150,598 probably null Het
Zfhx4 A G 3: 5,242,428 D238G probably damaging Het
Zfp639 A G 3: 32,519,661 H145R possibly damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATCCCATGTAATTAGCC -3'
(R):5'- GGTCTCACATTTAGCACCTGG -3'

Sequencing Primer
(F):5'- CATGTAATTAGCCTGAAAAATGCCC -3'
(R):5'- AGCTGATATTAGCCATTACTTCCTG -3'
Posted On2018-05-24