Incidental Mutation 'R6450:Mastl'
ID 519324
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
MMRRC Submission 044586-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23010941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 768 (T768A)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably damaging
Transcript: ENSMUST00000028119
AA Change: T768A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: T768A

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 119,815,449 (GRCm39) N232K probably benign Het
Acaca T A 11: 84,171,294 (GRCm39) V5E probably damaging Het
Adam18 A T 8: 25,119,691 (GRCm39) D529E probably benign Het
Adgrb3 T C 1: 25,459,683 (GRCm39) T798A probably benign Het
Alyref T C 11: 120,486,872 (GRCm39) T130A probably benign Het
Arhgap24 A G 5: 103,044,990 (GRCm39) S591G probably benign Het
Carmil1 C T 13: 24,220,547 (GRCm39) G655E probably damaging Het
Cdc42bpg T A 19: 6,364,518 (GRCm39) probably null Het
Clec12a T A 6: 129,330,366 (GRCm39) L48H probably damaging Het
Coq2 C A 5: 100,809,770 (GRCm39) probably benign Het
Crb2 C A 2: 37,683,838 (GRCm39) F1113L possibly damaging Het
Ctla4 A T 1: 60,951,872 (GRCm39) M134L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dync2i1 A T 12: 116,210,347 (GRCm39) Y314* probably null Het
Efhb A G 17: 53,759,632 (GRCm39) V290A possibly damaging Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Eva1a A T 6: 82,069,086 (GRCm39) I138F probably damaging Het
Fat2 T A 11: 55,180,136 (GRCm39) I1402F probably damaging Het
Fat3 A T 9: 15,910,466 (GRCm39) H1845Q possibly damaging Het
Gimap8 T A 6: 48,633,385 (GRCm39) F401L probably benign Het
Gpr162 C T 6: 124,838,152 (GRCm39) R166Q possibly damaging Het
H2ac8 A G 13: 23,755,119 (GRCm39) V55A probably damaging Het
Hdac4 G A 1: 91,912,433 (GRCm39) P348S possibly damaging Het
Hmcn2 T C 2: 31,251,812 (GRCm39) V849A probably benign Het
Inpp5b T A 4: 124,686,045 (GRCm39) N696K probably damaging Het
Kdm5d G T Y: 927,056 (GRCm39) R598L probably damaging Homo
Kidins220 T C 12: 25,107,190 (GRCm39) S1548P probably benign Het
Kif2b C A 11: 91,467,192 (GRCm39) V364L probably damaging Het
Kitl A G 10: 99,923,256 (GRCm39) M1V probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Map6 T C 7: 98,917,245 (GRCm39) I6T probably damaging Het
Mettl16 T C 11: 74,696,164 (GRCm39) V335A probably benign Het
Mpl T C 4: 118,305,897 (GRCm39) probably null Het
Myo5c C T 9: 75,193,860 (GRCm39) T1205I probably benign Het
Nav2 C A 7: 49,244,114 (GRCm39) L2114I probably damaging Het
Neb T A 2: 52,084,481 (GRCm39) K5330* probably null Het
Nfe2l1 C T 11: 96,718,161 (GRCm39) E125K possibly damaging Het
Onecut3 A G 10: 80,331,922 (GRCm39) K361E probably damaging Het
Or4f47 T A 2: 111,972,725 (GRCm39) L145* probably null Het
Osbpl6 A G 2: 76,395,174 (GRCm39) N370S possibly damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
P2rx4 A G 5: 122,865,304 (GRCm39) T310A possibly damaging Het
Pcdha11 G T 18: 37,146,215 (GRCm39) D769Y probably damaging Het
Pcgf6 C T 19: 47,037,527 (GRCm39) R124H probably benign Het
Pibf1 T A 14: 99,374,646 (GRCm39) Y362N probably damaging Het
Ppm1g T C 5: 31,360,468 (GRCm39) E422G probably benign Het
Prmt8 T C 6: 127,709,606 (GRCm39) I85V possibly damaging Het
Prss27 A T 17: 24,263,988 (GRCm39) K225* probably null Het
Rai1 A T 11: 60,077,429 (GRCm39) T498S probably benign Het
Sbf2 C A 7: 110,062,070 (GRCm39) G23V probably damaging Het
Sdha C T 13: 74,482,412 (GRCm39) probably null Het
Sgo2a C T 1: 58,042,092 (GRCm39) Q140* probably null Het
Sh3rf3 A G 10: 58,819,966 (GRCm39) D259G probably damaging Het
Slc27a3 C A 3: 90,292,777 (GRCm39) D631Y probably damaging Het
Slc7a10 T C 7: 34,886,015 (GRCm39) S37P possibly damaging Het
Slco6d1 A G 1: 98,349,192 (GRCm39) T88A probably benign Het
Smad4 A T 18: 73,810,817 (GRCm39) S56T possibly damaging Het
Smarcd1 A G 15: 99,605,766 (GRCm39) I346V possibly damaging Het
Spast C T 17: 74,675,835 (GRCm39) P260S probably benign Het
Spata31f1e C A 4: 42,792,489 (GRCm39) G548W probably damaging Het
Sprr2i A T 3: 92,316,017 (GRCm39) probably benign Het
Sptbn5 A G 2: 119,877,616 (GRCm39) probably benign Het
Taar9 A T 10: 23,985,138 (GRCm39) Y99N probably damaging Het
Trappc10 A T 10: 78,045,284 (GRCm39) M468K possibly damaging Het
Trim66 T C 7: 109,059,945 (GRCm39) R814G probably benign Het
Tspan31 A G 10: 126,904,227 (GRCm39) C157R probably damaging Het
Vmn2r90 A G 17: 17,953,498 (GRCm39) D554G possibly damaging Het
Vmn2r91 A T 17: 18,305,527 (GRCm39) D70V probably damaging Het
Wdfy4 C T 14: 32,830,649 (GRCm39) G928R probably damaging Het
Zfp346 G T 13: 55,261,517 (GRCm39) K102N probably damaging Het
Zmym4 G A 4: 126,789,099 (GRCm39) P1002S probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R0712:Mastl UTSW 2 23,041,005 (GRCm39) missense probably damaging 1.00
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3799:Mastl UTSW 2 23,030,504 (GRCm39) splice site probably benign
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4818:Mastl UTSW 2 23,027,038 (GRCm39) missense probably benign 0.00
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5338:Mastl UTSW 2 23,023,503 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6788:Mastl UTSW 2 23,023,710 (GRCm39) missense probably benign 0.22
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- GAGGAGCTACACTTGGGTATGG -3'
(R):5'- TGCCTGAATGAAGGTAATTTGAGG -3'

Sequencing Primer
(F):5'- CTTGAAGAAATCAATGCCTTTCTGG -3'
(R):5'- GAGGTTTTGTAACTGTATAGAAACCG -3'
Posted On 2018-05-24