Mutagenetix > Incidental Mutation

Incidental Mutation 'R6450:Mastl'

519324

Institutional Source

Beutler Lab

Gene Symbol

Mastl

Ensembl Gene

ENSMUSG00000026779

Gene Name

microtubule associated serine/threonine kinase-like

Synonyms

2700091H24Rik, THC2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6450 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23115606-23156024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23120929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 768 (T768A)

Ref Sequence

ENSEMBL: ENSMUSP00000028119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028119]

AlphaFold

Q8C0P0

Predicted Effect

probably damaging
Transcript: ENSMUST00000028119
AA Change: T768A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: T768A

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:Pkinase_Tyr	34	194	2.6e-24	PFAM
Pfam:Pkinase	34	200	2.3e-39	PFAM
low complexity region	297	313	N/A	INTRINSIC
Pfam:Pkinase	710	821	6.4e-19	PFAM
Pfam:Pkinase_Tyr	714	818	5.1e-6	PFAM
S_TK_X	822	864	2.01e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.5%
20x: 95.1%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	C	G	7: 120,216,226	N232K	probably benign	Het
Acaca	T	A	11: 84,280,468	V5E	probably damaging	Het
Adam18	A	T	8: 24,629,675	D529E	probably benign	Het
Adgrb3	T	C	1: 25,420,602	T798A	probably benign	Het
Alyref	T	C	11: 120,596,046	T130A	probably benign	Het
Arhgap24	A	G	5: 102,897,124	S591G	probably benign	Het
Carmil1	C	T	13: 24,036,564	G655E	probably damaging	Het
Cdc42bpg	T	A	19: 6,314,488		probably null	Het
Clec12a	T	A	6: 129,353,403	L48H	probably damaging	Het
Coq2	C	A	5: 100,661,904		probably benign	Het
Crb2	C	A	2: 37,793,826	F1113L	possibly damaging	Het
Ctla4	A	T	1: 60,912,713	M134L	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Efhb	A	G	17: 53,452,604	V290A	possibly damaging	Het
Epha8	T	C	4: 136,931,899	N843S	probably damaging	Het
Eva1a	A	T	6: 82,092,105	I138F	probably damaging	Het
Fat2	T	A	11: 55,289,310	I1402F	probably damaging	Het
Fat3	A	T	9: 15,999,170	H1845Q	possibly damaging	Het
Gimap8	T	A	6: 48,656,451	F401L	probably benign	Het
Gm12394	C	A	4: 42,792,489	G548W	probably damaging	Het
Gpr162	C	T	6: 124,861,189	R166Q	possibly damaging	Het
Hdac4	G	A	1: 91,984,711	P348S	possibly damaging	Het
Hist1h2ae	A	G	13: 23,570,945	V55A	probably damaging	Het
Hmcn2	T	C	2: 31,361,800	V849A	probably benign	Het
Inpp5b	T	A	4: 124,792,252	N696K	probably damaging	Het
Kdm5d	G	T	Y: 927,056	R598L	probably damaging	Homo
Kidins220	T	C	12: 25,057,191	S1548P	probably benign	Het
Kif2b	C	A	11: 91,576,366	V364L	probably damaging	Het
Kitl	A	G	10: 100,087,394	M1V	probably null	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Map6	T	C	7: 99,268,038	I6T	probably damaging	Het
Mettl16	T	C	11: 74,805,338	V335A	probably benign	Het
Mpl	T	C	4: 118,448,700		probably null	Het
Myo5c	C	T	9: 75,286,578	T1205I	probably benign	Het
Nav2	C	A	7: 49,594,366	L2114I	probably damaging	Het
Neb	T	A	2: 52,194,469	K5330*	probably null	Het
Nfe2l1	C	T	11: 96,827,335	E125K	possibly damaging	Het
Olfr1317	T	A	2: 112,142,380	L145*	probably null	Het
Onecut3	A	G	10: 80,496,088	K361E	probably damaging	Het
Osbpl6	A	G	2: 76,564,830	N370S	possibly damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
P2rx4	A	G	5: 122,727,241	T310A	possibly damaging	Het
Pcdha11	G	T	18: 37,013,162	D769Y	probably damaging	Het
Pcgf6	C	T	19: 47,049,088	R124H	probably benign	Het
Pibf1	T	A	14: 99,137,210	Y362N	probably damaging	Het
Ppm1g	T	C	5: 31,203,124	E422G	probably benign	Het
Prmt8	T	C	6: 127,732,643	I85V	possibly damaging	Het
Prss27	A	T	17: 24,045,014	K225*	probably null	Het
Rai1	A	T	11: 60,186,603	T498S	probably benign	Het
Sbf2	C	A	7: 110,462,863	G23V	probably damaging	Het
Sdha	C	T	13: 74,334,293		probably null	Het
Sgo2a	C	T	1: 58,002,933	Q140*	probably null	Het
Sh3rf3	A	G	10: 58,984,144	D259G	probably damaging	Het
Slc27a3	C	A	3: 90,385,470	D631Y	probably damaging	Het
Slc7a10	T	C	7: 35,186,590	S37P	possibly damaging	Het
Slco6d1	A	G	1: 98,421,467	T88A	probably benign	Het
Smad4	A	T	18: 73,677,746	S56T	possibly damaging	Het
Smarcd1	A	G	15: 99,707,885	I346V	possibly damaging	Het
Spast	C	T	17: 74,368,840	P260S	probably benign	Het
Sprr2i	A	T	3: 92,408,710		probably benign	Het
Sptbn5	A	G	2: 120,047,135		probably benign	Het
Taar9	A	T	10: 24,109,240	Y99N	probably damaging	Het
Trappc10	A	T	10: 78,209,450	M468K	possibly damaging	Het
Trim66	T	C	7: 109,460,738	R814G	probably benign	Het
Tspan31	A	G	10: 127,068,358	C157R	probably damaging	Het
Vmn2r90	A	G	17: 17,733,236	D554G	possibly damaging	Het
Vmn2r91	A	T	17: 18,085,265	D70V	probably damaging	Het
Wdfy4	C	T	14: 33,108,692	G928R	probably damaging	Het
Wdr60	A	T	12: 116,246,727	Y314*	probably null	Het
Zfp346	G	T	13: 55,113,704	K102N	probably damaging	Het
Zmym4	G	A	4: 126,895,306	P1002S	probably damaging	Het

Other mutations in Mastl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Mastl	APN	2	23146148	missense	probably damaging	1.00
IGL02103:Mastl	APN	2	23139998	missense	probably benign	0.01
IGL02622:Mastl	APN	2	23132845	missense	probably benign	0.12
IGL02826:Mastl	APN	2	23145409	missense	probably damaging	1.00
IGL02896:Mastl	APN	2	23131767	missense	probably damaging	1.00
IGL03024:Mastl	APN	2	23139919	missense	probably damaging	1.00
IGL03038:Mastl	APN	2	23140615	splice site	probably benign
R0600:Mastl	UTSW	2	23133346	missense	probably benign	0.06
R0712:Mastl	UTSW	2	23150993	missense	probably damaging	1.00
R1168:Mastl	UTSW	2	23133132	missense	probably benign	0.06
R1750:Mastl	UTSW	2	23146081	nonsense	probably null
R1911:Mastl	UTSW	2	23132680	nonsense	probably null
R2051:Mastl	UTSW	2	23132824	missense	possibly damaging	0.49
R2859:Mastl	UTSW	2	23139967	missense	probably damaging	0.99
R3799:Mastl	UTSW	2	23140492	splice site	probably benign
R3840:Mastl	UTSW	2	23140551	missense	probably damaging	1.00
R4807:Mastl	UTSW	2	23132843	missense	probably benign
R4818:Mastl	UTSW	2	23137026	missense	probably benign	0.00
R4845:Mastl	UTSW	2	23139998	missense	probably benign	0.01
R5338:Mastl	UTSW	2	23133491	missense	probably benign	0.01
R5364:Mastl	UTSW	2	23133653	missense	probably benign	0.16
R6077:Mastl	UTSW	2	23155794	missense	probably damaging	0.99
R6158:Mastl	UTSW	2	23132772	missense	possibly damaging	0.92
R6602:Mastl	UTSW	2	23132677	missense	probably benign	0.04
R6788:Mastl	UTSW	2	23133698	missense	probably benign	0.22
R6908:Mastl	UTSW	2	23155976	start gained	probably benign
R7058:Mastl	UTSW	2	23133413	nonsense	probably null
R7233:Mastl	UTSW	2	23133658	missense	probably benign
R7249:Mastl	UTSW	2	23146139	missense	probably damaging	1.00
R7347:Mastl	UTSW	2	23133389	missense	probably damaging	0.99
R7371:Mastl	UTSW	2	23140573	missense	probably damaging	1.00
R7726:Mastl	UTSW	2	23140795	splice site	probably null
R8057:Mastl	UTSW	2	23133554	missense	possibly damaging	0.75
R8288:Mastl	UTSW	2	23133359	missense	probably damaging	1.00
R9101:Mastl	UTSW	2	23118437	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGGAGCTACACTTGGGTATGG -3'
(R):5'- TGCCTGAATGAAGGTAATTTGAGG -3'

Sequencing Primer
(F):5'- CTTGAAGAAATCAATGCCTTTCTGG -3'
(R):5'- GAGGTTTTGTAACTGTATAGAAACCG -3'

Posted On

2018-05-24