Incidental Mutation 'R6450:Mastl'
ID519324
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6450 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23120929 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 768 (T768A)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect probably damaging
Transcript: ENSMUST00000028119
AA Change: T768A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: T768A

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAGCTACACTTGGGTATGG -3'
(R):5'- TGCCTGAATGAAGGTAATTTGAGG -3'

Sequencing Primer
(F):5'- CTTGAAGAAATCAATGCCTTTCTGG -3'
(R):5'- GAGGTTTTGTAACTGTATAGAAACCG -3'
Posted On2018-05-24