Incidental Mutation 'R6450:Mpl'
ID519334
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6450 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118448700 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
Predicted Effect probably null
Transcript: ENSMUST00000006556
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102671
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106375
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7100:Mpl UTSW 4 118457410 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7177:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
Predicted Primers PCR Primer
(F):5'- GACAGTGTTGACCTGGGAATG -3'
(R):5'- GGCTGGTAAGAACCTTCCTTCC -3'

Sequencing Primer
(F):5'- GTGTGCAGTTTCCCATGAACAC -3'
(R):5'- GGTAAGAACCTTCCTTCCATATTCC -3'
Posted On2018-05-24