Mutagenetix > Incidental Mutation

Incidental Mutation 'R6450:Mpl'

519334

Institutional Source

Beutler Lab

Gene Symbol

Mpl

Ensembl Gene

ENSMUSG00000006389

Gene Name

myeloproliferative leukemia virus oncogene

Synonyms

TPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6450 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118442415-118457513 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 118448700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]

AlphaFold

Q08351

Predicted Effect

probably null
Transcript: ENSMUST00000006556

SMART Domains

Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	1.9e-31	PFAM
Pfam:IL6Ra-bind	27	118	1.8e-7	PFAM
FN3	126	257	7.7e-3	SMART
FN3	382	461	2.83e0	SMART
transmembrane domain	483	505	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102671

SMART Domains

Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.4e-32	PFAM
Pfam:IL6Ra-bind	34	125	7.3e-9	PFAM
FN3	133	256	1.09e-2	SMART
FN3	381	460	2.83e0	SMART
transmembrane domain	482	504	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106375

SMART Domains

Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	9.4e-32	PFAM
Pfam:IL6Ra-bind	27	119	7.4e-8	PFAM
FN3	322	401	2.83e0	SMART
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168404

SMART Domains

Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.9e-31	PFAM
FN3	133	264	7.7e-3	SMART
FN3	389	468	2.83e0	SMART
transmembrane domain	490	512	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.5%
20x: 95.1%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	C	G	7: 120,216,226	N232K	probably benign	Het
Acaca	T	A	11: 84,280,468	V5E	probably damaging	Het
Adam18	A	T	8: 24,629,675	D529E	probably benign	Het
Adgrb3	T	C	1: 25,420,602	T798A	probably benign	Het
Alyref	T	C	11: 120,596,046	T130A	probably benign	Het
Arhgap24	A	G	5: 102,897,124	S591G	probably benign	Het
Carmil1	C	T	13: 24,036,564	G655E	probably damaging	Het
Cdc42bpg	T	A	19: 6,314,488		probably null	Het
Clec12a	T	A	6: 129,353,403	L48H	probably damaging	Het
Coq2	C	A	5: 100,661,904		probably benign	Het
Crb2	C	A	2: 37,793,826	F1113L	possibly damaging	Het
Ctla4	A	T	1: 60,912,713	M134L	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Efhb	A	G	17: 53,452,604	V290A	possibly damaging	Het
Epha8	T	C	4: 136,931,899	N843S	probably damaging	Het
Eva1a	A	T	6: 82,092,105	I138F	probably damaging	Het
Fat2	T	A	11: 55,289,310	I1402F	probably damaging	Het
Fat3	A	T	9: 15,999,170	H1845Q	possibly damaging	Het
Gimap8	T	A	6: 48,656,451	F401L	probably benign	Het
Gm12394	C	A	4: 42,792,489	G548W	probably damaging	Het
Gpr162	C	T	6: 124,861,189	R166Q	possibly damaging	Het
Hdac4	G	A	1: 91,984,711	P348S	possibly damaging	Het
Hist1h2ae	A	G	13: 23,570,945	V55A	probably damaging	Het
Hmcn2	T	C	2: 31,361,800	V849A	probably benign	Het
Inpp5b	T	A	4: 124,792,252	N696K	probably damaging	Het
Kdm5d	G	T	Y: 927,056	R598L	probably damaging	Homo
Kidins220	T	C	12: 25,057,191	S1548P	probably benign	Het
Kif2b	C	A	11: 91,576,366	V364L	probably damaging	Het
Kitl	A	G	10: 100,087,394	M1V	probably null	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Map6	T	C	7: 99,268,038	I6T	probably damaging	Het
Mastl	T	C	2: 23,120,929	T768A	probably damaging	Het
Mettl16	T	C	11: 74,805,338	V335A	probably benign	Het
Myo5c	C	T	9: 75,286,578	T1205I	probably benign	Het
Nav2	C	A	7: 49,594,366	L2114I	probably damaging	Het
Neb	T	A	2: 52,194,469	K5330*	probably null	Het
Nfe2l1	C	T	11: 96,827,335	E125K	possibly damaging	Het
Olfr1317	T	A	2: 112,142,380	L145*	probably null	Het
Onecut3	A	G	10: 80,496,088	K361E	probably damaging	Het
Osbpl6	A	G	2: 76,564,830	N370S	possibly damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
P2rx4	A	G	5: 122,727,241	T310A	possibly damaging	Het
Pcdha11	G	T	18: 37,013,162	D769Y	probably damaging	Het
Pcgf6	C	T	19: 47,049,088	R124H	probably benign	Het
Pibf1	T	A	14: 99,137,210	Y362N	probably damaging	Het
Ppm1g	T	C	5: 31,203,124	E422G	probably benign	Het
Prmt8	T	C	6: 127,732,643	I85V	possibly damaging	Het
Prss27	A	T	17: 24,045,014	K225*	probably null	Het
Rai1	A	T	11: 60,186,603	T498S	probably benign	Het
Sbf2	C	A	7: 110,462,863	G23V	probably damaging	Het
Sdha	C	T	13: 74,334,293		probably null	Het
Sgo2a	C	T	1: 58,002,933	Q140*	probably null	Het
Sh3rf3	A	G	10: 58,984,144	D259G	probably damaging	Het
Slc27a3	C	A	3: 90,385,470	D631Y	probably damaging	Het
Slc7a10	T	C	7: 35,186,590	S37P	possibly damaging	Het
Slco6d1	A	G	1: 98,421,467	T88A	probably benign	Het
Smad4	A	T	18: 73,677,746	S56T	possibly damaging	Het
Smarcd1	A	G	15: 99,707,885	I346V	possibly damaging	Het
Spast	C	T	17: 74,368,840	P260S	probably benign	Het
Sprr2i	A	T	3: 92,408,710		probably benign	Het
Sptbn5	A	G	2: 120,047,135		probably benign	Het
Taar9	A	T	10: 24,109,240	Y99N	probably damaging	Het
Trappc10	A	T	10: 78,209,450	M468K	possibly damaging	Het
Trim66	T	C	7: 109,460,738	R814G	probably benign	Het
Tspan31	A	G	10: 127,068,358	C157R	probably damaging	Het
Vmn2r90	A	G	17: 17,733,236	D554G	possibly damaging	Het
Vmn2r91	A	T	17: 18,085,265	D70V	probably damaging	Het
Wdfy4	C	T	14: 33,108,692	G928R	probably damaging	Het
Wdr60	A	T	12: 116,246,727	Y314*	probably null	Het
Zfp346	G	T	13: 55,113,704	K102N	probably damaging	Het
Zmym4	G	A	4: 126,895,306	P1002S	probably damaging	Het

Other mutations in Mpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Mpl	APN	4	118455661	missense	possibly damaging	0.94
IGL02096:Mpl	APN	4	118457136	missense	possibly damaging	0.46
IGL02681:Mpl	APN	4	118448871	splice site	probably benign
R0238:Mpl	UTSW	4	118456863	splice site	probably benign
R0309:Mpl	UTSW	4	118446038	intron	probably benign
R0539:Mpl	UTSW	4	118443508	missense	possibly damaging	0.68
R0558:Mpl	UTSW	4	118444020	missense	probably damaging	0.99
R0601:Mpl	UTSW	4	118443536	missense	probably benign	0.08
R0784:Mpl	UTSW	4	118446406	missense	possibly damaging	0.59
R1016:Mpl	UTSW	4	118448913	missense	probably damaging	1.00
R1532:Mpl	UTSW	4	118448568	missense	possibly damaging	0.63
R1590:Mpl	UTSW	4	118444024	missense	probably damaging	0.99
R1806:Mpl	UTSW	4	118443532	missense	possibly damaging	0.73
R1875:Mpl	UTSW	4	118456829	missense	probably benign
R1935:Mpl	UTSW	4	118455739	missense	probably benign	0.01
R2182:Mpl	UTSW	4	118457413	missense	probably benign
R2291:Mpl	UTSW	4	118449000	missense	probably benign	0.04
R2508:Mpl	UTSW	4	118455757	missense	probably damaging	1.00
R4242:Mpl	UTSW	4	118456771	missense	probably damaging	0.98
R4718:Mpl	UTSW	4	118456724	missense	probably benign	0.02
R4775:Mpl	UTSW	4	118448580	missense	probably damaging	1.00
R5158:Mpl	UTSW	4	118456684	missense	probably damaging	0.98
R5208:Mpl	UTSW	4	118455881	missense	probably benign	0.00
R5276:Mpl	UTSW	4	118455721	missense	probably benign
R5953:Mpl	UTSW	4	118454510	missense	possibly damaging	0.89
R5953:Mpl	UTSW	4	118454511	missense	probably damaging	0.99
R6439:Mpl	UTSW	4	118448553	missense	probably damaging	0.98
R6521:Mpl	UTSW	4	118455117	critical splice donor site	probably null
R6812:Mpl	UTSW	4	118455264	missense	probably benign	0.03
R6876:Mpl	UTSW	4	118457120	missense	probably damaging	1.00
R7095:Mpl	UTSW	4	118444063	missense
R7100:Mpl	UTSW	4	118457410	missense
R7173:Mpl	UTSW	4	118448544	critical splice donor site	probably null
R7177:Mpl	UTSW	4	118448544	critical splice donor site	probably null
R7512:Mpl	UTSW	4	118448892	missense
R8377:Mpl	UTSW	4	118444057	missense
R8411:Mpl	UTSW	4	118446109	missense
R8458:Mpl	UTSW	4	118444016	critical splice donor site	probably null
R8498:Mpl	UTSW	4	118449010	missense	probably benign
R8672:Mpl	UTSW	4	118448913	missense	probably damaging	1.00
R8863:Mpl	UTSW	4	118457405	missense
R8904:Mpl	UTSW	4	118444066	missense
Z1177:Mpl	UTSW	4	118443655	missense

Predicted Primers

PCR Primer
(F):5'- GACAGTGTTGACCTGGGAATG -3'
(R):5'- GGCTGGTAAGAACCTTCCTTCC -3'

Sequencing Primer
(F):5'- GTGTGCAGTTTCCCATGAACAC -3'
(R):5'- GGTAAGAACCTTCCTTCCATATTCC -3'

Posted On

2018-05-24