Incidental Mutation 'R6450:P2rx4'
ID 519340
Institutional Source Beutler Lab
Gene Symbol P2rx4
Ensembl Gene ENSMUSG00000029470
Gene Name purinergic receptor P2X, ligand-gated ion channel 4
Synonyms D5Ertd444e, P2X4
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 122707544-122729738 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122727241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000031429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000111668] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031429
AA Change: T310A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: T310A

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081554
AA Change: T283A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: T283A

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 1.6e-72 PFAM
Pfam:P2X_receptor 170 361 2.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111668
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132062
Predicted Effect possibly damaging
Transcript: ENSMUST00000139631
AA Change: T283A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: T283A

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 3.7e-73 PFAM
Pfam:P2X_receptor 171 301 4.6e-59 PFAM
Pfam:P2X_receptor 299 331 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139712
Predicted Effect probably benign
Transcript: ENSMUST00000142664
AA Change: T310A

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: T310A

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 358 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198560
SMART Domains Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 47 6.9e-9 PFAM
Meta Mutation Damage Score 0.6951 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in P2rx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:P2rx4 UTSW 5 122714404 missense probably damaging 1.00
R1081:P2rx4 UTSW 5 122727233 missense probably damaging 0.98
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R3434:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R3435:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R5090:P2rx4 UTSW 5 122725055 missense probably damaging 1.00
R5318:P2rx4 UTSW 5 122719148 missense probably null 1.00
R5888:P2rx4 UTSW 5 122719165 missense probably benign
R5888:P2rx4 UTSW 5 122727208 missense probably damaging 1.00
R5994:P2rx4 UTSW 5 122725079 missense probably damaging 1.00
R6478:P2rx4 UTSW 5 122707700 missense probably damaging 0.99
R6847:P2rx4 UTSW 5 122727751 missense probably damaging 1.00
X0064:P2rx4 UTSW 5 122707779 nonsense probably null
X0066:P2rx4 UTSW 5 122707745 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACATTAACTAGGAGGCTGACC -3'
(R):5'- GGATGATGTCAAACTTGCCAGC -3'

Sequencing Primer
(F):5'- TGCTTGGTGTCTGCGAAG -3'
(R):5'- CCAGCCTGGCGGAAGAC -3'
Posted On 2018-05-24