Incidental Mutation 'R6450:Map6'
ID 519349
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 044586-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98917245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 6 (I6T)
Ref Sequence ENSEMBL: ENSMUSP00000146585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: I6T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: I6T

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: I6T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: I6T

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: I6T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180761
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: I6T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208978
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Meta Mutation Damage Score 0.8825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 119,815,449 (GRCm39) N232K probably benign Het
Acaca T A 11: 84,171,294 (GRCm39) V5E probably damaging Het
Adam18 A T 8: 25,119,691 (GRCm39) D529E probably benign Het
Adgrb3 T C 1: 25,459,683 (GRCm39) T798A probably benign Het
Alyref T C 11: 120,486,872 (GRCm39) T130A probably benign Het
Arhgap24 A G 5: 103,044,990 (GRCm39) S591G probably benign Het
Carmil1 C T 13: 24,220,547 (GRCm39) G655E probably damaging Het
Cdc42bpg T A 19: 6,364,518 (GRCm39) probably null Het
Clec12a T A 6: 129,330,366 (GRCm39) L48H probably damaging Het
Coq2 C A 5: 100,809,770 (GRCm39) probably benign Het
Crb2 C A 2: 37,683,838 (GRCm39) F1113L possibly damaging Het
Ctla4 A T 1: 60,951,872 (GRCm39) M134L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dync2i1 A T 12: 116,210,347 (GRCm39) Y314* probably null Het
Efhb A G 17: 53,759,632 (GRCm39) V290A possibly damaging Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Eva1a A T 6: 82,069,086 (GRCm39) I138F probably damaging Het
Fat2 T A 11: 55,180,136 (GRCm39) I1402F probably damaging Het
Fat3 A T 9: 15,910,466 (GRCm39) H1845Q possibly damaging Het
Gimap8 T A 6: 48,633,385 (GRCm39) F401L probably benign Het
Gpr162 C T 6: 124,838,152 (GRCm39) R166Q possibly damaging Het
H2ac8 A G 13: 23,755,119 (GRCm39) V55A probably damaging Het
Hdac4 G A 1: 91,912,433 (GRCm39) P348S possibly damaging Het
Hmcn2 T C 2: 31,251,812 (GRCm39) V849A probably benign Het
Inpp5b T A 4: 124,686,045 (GRCm39) N696K probably damaging Het
Kdm5d G T Y: 927,056 (GRCm39) R598L probably damaging Homo
Kidins220 T C 12: 25,107,190 (GRCm39) S1548P probably benign Het
Kif2b C A 11: 91,467,192 (GRCm39) V364L probably damaging Het
Kitl A G 10: 99,923,256 (GRCm39) M1V probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Mastl T C 2: 23,010,941 (GRCm39) T768A probably damaging Het
Mettl16 T C 11: 74,696,164 (GRCm39) V335A probably benign Het
Mpl T C 4: 118,305,897 (GRCm39) probably null Het
Myo5c C T 9: 75,193,860 (GRCm39) T1205I probably benign Het
Nav2 C A 7: 49,244,114 (GRCm39) L2114I probably damaging Het
Neb T A 2: 52,084,481 (GRCm39) K5330* probably null Het
Nfe2l1 C T 11: 96,718,161 (GRCm39) E125K possibly damaging Het
Onecut3 A G 10: 80,331,922 (GRCm39) K361E probably damaging Het
Or4f47 T A 2: 111,972,725 (GRCm39) L145* probably null Het
Osbpl6 A G 2: 76,395,174 (GRCm39) N370S possibly damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
P2rx4 A G 5: 122,865,304 (GRCm39) T310A possibly damaging Het
Pcdha11 G T 18: 37,146,215 (GRCm39) D769Y probably damaging Het
Pcgf6 C T 19: 47,037,527 (GRCm39) R124H probably benign Het
Pibf1 T A 14: 99,374,646 (GRCm39) Y362N probably damaging Het
Ppm1g T C 5: 31,360,468 (GRCm39) E422G probably benign Het
Prmt8 T C 6: 127,709,606 (GRCm39) I85V possibly damaging Het
Prss27 A T 17: 24,263,988 (GRCm39) K225* probably null Het
Rai1 A T 11: 60,077,429 (GRCm39) T498S probably benign Het
Sbf2 C A 7: 110,062,070 (GRCm39) G23V probably damaging Het
Sdha C T 13: 74,482,412 (GRCm39) probably null Het
Sgo2a C T 1: 58,042,092 (GRCm39) Q140* probably null Het
Sh3rf3 A G 10: 58,819,966 (GRCm39) D259G probably damaging Het
Slc27a3 C A 3: 90,292,777 (GRCm39) D631Y probably damaging Het
Slc7a10 T C 7: 34,886,015 (GRCm39) S37P possibly damaging Het
Slco6d1 A G 1: 98,349,192 (GRCm39) T88A probably benign Het
Smad4 A T 18: 73,810,817 (GRCm39) S56T possibly damaging Het
Smarcd1 A G 15: 99,605,766 (GRCm39) I346V possibly damaging Het
Spast C T 17: 74,675,835 (GRCm39) P260S probably benign Het
Spata31f1e C A 4: 42,792,489 (GRCm39) G548W probably damaging Het
Sprr2i A T 3: 92,316,017 (GRCm39) probably benign Het
Sptbn5 A G 2: 119,877,616 (GRCm39) probably benign Het
Taar9 A T 10: 23,985,138 (GRCm39) Y99N probably damaging Het
Trappc10 A T 10: 78,045,284 (GRCm39) M468K possibly damaging Het
Trim66 T C 7: 109,059,945 (GRCm39) R814G probably benign Het
Tspan31 A G 10: 126,904,227 (GRCm39) C157R probably damaging Het
Vmn2r90 A G 17: 17,953,498 (GRCm39) D554G possibly damaging Het
Vmn2r91 A T 17: 18,305,527 (GRCm39) D70V probably damaging Het
Wdfy4 C T 14: 32,830,649 (GRCm39) G928R probably damaging Het
Zfp346 G T 13: 55,261,517 (GRCm39) K102N probably damaging Het
Zmym4 G A 4: 126,789,099 (GRCm39) P1002S probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTATCTCAGCGGTACCTTGTC -3'
(R):5'- AGTCCTTCTGGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCCCCGGGTGCTCTTTGAG -3'
(R):5'- TAGTCCTGTCGCATCACCGAG -3'
Posted On 2018-05-24