Incidental Mutation 'R6450:Adam18'
ID519353
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6450 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24629675 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 529 (D529E)
Ref Sequence ENSEMBL: ENSMUSP00000033957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000138232] [ENSMUST00000173833]
Predicted Effect probably benign
Transcript: ENSMUST00000033957
AA Change: D529E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: D529E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138232
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: D529E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: D529E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 V132F unknown Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1578P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5573* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G169V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 V1012A probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 unclassified probably benign
IGL02966:Adam18 APN 8 24611149 unclassified probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCACGCACTCCTTTGATGGG -3'
(R):5'- AAAGCACGCCCATTTTGAAATG -3'

Sequencing Primer
(F):5'- CTACTGAGTGAGTTCCAGGAC -3'
(R):5'- GCTTTAGGTTCTCAAGGG -3'
Posted On2018-05-24