Incidental Mutation 'R6450:Acaca'
ID 519366
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 044586-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84171294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 5 (V5E)
Ref Sequence ENSEMBL: ENSMUSP00000139378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect possibly damaging
Transcript: ENSMUST00000020843
AA Change: V1176E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: V1176E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103201
AA Change: V1176E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: V1176E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183887
AA Change: V5E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532
AA Change: V5E

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Meta Mutation Damage Score 0.6710 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 119,815,449 (GRCm39) N232K probably benign Het
Adam18 A T 8: 25,119,691 (GRCm39) D529E probably benign Het
Adgrb3 T C 1: 25,459,683 (GRCm39) T798A probably benign Het
Alyref T C 11: 120,486,872 (GRCm39) T130A probably benign Het
Arhgap24 A G 5: 103,044,990 (GRCm39) S591G probably benign Het
Carmil1 C T 13: 24,220,547 (GRCm39) G655E probably damaging Het
Cdc42bpg T A 19: 6,364,518 (GRCm39) probably null Het
Clec12a T A 6: 129,330,366 (GRCm39) L48H probably damaging Het
Coq2 C A 5: 100,809,770 (GRCm39) probably benign Het
Crb2 C A 2: 37,683,838 (GRCm39) F1113L possibly damaging Het
Ctla4 A T 1: 60,951,872 (GRCm39) M134L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dync2i1 A T 12: 116,210,347 (GRCm39) Y314* probably null Het
Efhb A G 17: 53,759,632 (GRCm39) V290A possibly damaging Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Eva1a A T 6: 82,069,086 (GRCm39) I138F probably damaging Het
Fat2 T A 11: 55,180,136 (GRCm39) I1402F probably damaging Het
Fat3 A T 9: 15,910,466 (GRCm39) H1845Q possibly damaging Het
Gimap8 T A 6: 48,633,385 (GRCm39) F401L probably benign Het
Gpr162 C T 6: 124,838,152 (GRCm39) R166Q possibly damaging Het
H2ac8 A G 13: 23,755,119 (GRCm39) V55A probably damaging Het
Hdac4 G A 1: 91,912,433 (GRCm39) P348S possibly damaging Het
Hmcn2 T C 2: 31,251,812 (GRCm39) V849A probably benign Het
Inpp5b T A 4: 124,686,045 (GRCm39) N696K probably damaging Het
Kdm5d G T Y: 927,056 (GRCm39) R598L probably damaging Homo
Kidins220 T C 12: 25,107,190 (GRCm39) S1548P probably benign Het
Kif2b C A 11: 91,467,192 (GRCm39) V364L probably damaging Het
Kitl A G 10: 99,923,256 (GRCm39) M1V probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Map6 T C 7: 98,917,245 (GRCm39) I6T probably damaging Het
Mastl T C 2: 23,010,941 (GRCm39) T768A probably damaging Het
Mettl16 T C 11: 74,696,164 (GRCm39) V335A probably benign Het
Mpl T C 4: 118,305,897 (GRCm39) probably null Het
Myo5c C T 9: 75,193,860 (GRCm39) T1205I probably benign Het
Nav2 C A 7: 49,244,114 (GRCm39) L2114I probably damaging Het
Neb T A 2: 52,084,481 (GRCm39) K5330* probably null Het
Nfe2l1 C T 11: 96,718,161 (GRCm39) E125K possibly damaging Het
Onecut3 A G 10: 80,331,922 (GRCm39) K361E probably damaging Het
Or4f47 T A 2: 111,972,725 (GRCm39) L145* probably null Het
Osbpl6 A G 2: 76,395,174 (GRCm39) N370S possibly damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
P2rx4 A G 5: 122,865,304 (GRCm39) T310A possibly damaging Het
Pcdha11 G T 18: 37,146,215 (GRCm39) D769Y probably damaging Het
Pcgf6 C T 19: 47,037,527 (GRCm39) R124H probably benign Het
Pibf1 T A 14: 99,374,646 (GRCm39) Y362N probably damaging Het
Ppm1g T C 5: 31,360,468 (GRCm39) E422G probably benign Het
Prmt8 T C 6: 127,709,606 (GRCm39) I85V possibly damaging Het
Prss27 A T 17: 24,263,988 (GRCm39) K225* probably null Het
Rai1 A T 11: 60,077,429 (GRCm39) T498S probably benign Het
Sbf2 C A 7: 110,062,070 (GRCm39) G23V probably damaging Het
Sdha C T 13: 74,482,412 (GRCm39) probably null Het
Sgo2a C T 1: 58,042,092 (GRCm39) Q140* probably null Het
Sh3rf3 A G 10: 58,819,966 (GRCm39) D259G probably damaging Het
Slc27a3 C A 3: 90,292,777 (GRCm39) D631Y probably damaging Het
Slc7a10 T C 7: 34,886,015 (GRCm39) S37P possibly damaging Het
Slco6d1 A G 1: 98,349,192 (GRCm39) T88A probably benign Het
Smad4 A T 18: 73,810,817 (GRCm39) S56T possibly damaging Het
Smarcd1 A G 15: 99,605,766 (GRCm39) I346V possibly damaging Het
Spast C T 17: 74,675,835 (GRCm39) P260S probably benign Het
Spata31f1e C A 4: 42,792,489 (GRCm39) G548W probably damaging Het
Sprr2i A T 3: 92,316,017 (GRCm39) probably benign Het
Sptbn5 A G 2: 119,877,616 (GRCm39) probably benign Het
Taar9 A T 10: 23,985,138 (GRCm39) Y99N probably damaging Het
Trappc10 A T 10: 78,045,284 (GRCm39) M468K possibly damaging Het
Trim66 T C 7: 109,059,945 (GRCm39) R814G probably benign Het
Tspan31 A G 10: 126,904,227 (GRCm39) C157R probably damaging Het
Vmn2r90 A G 17: 17,953,498 (GRCm39) D554G possibly damaging Het
Vmn2r91 A T 17: 18,305,527 (GRCm39) D70V probably damaging Het
Wdfy4 C T 14: 32,830,649 (GRCm39) G928R probably damaging Het
Zfp346 G T 13: 55,261,517 (GRCm39) K102N probably damaging Het
Zmym4 G A 4: 126,789,099 (GRCm39) P1002S probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTTAAGGGTCTTGCACC -3'
(R):5'- GGGTTCATTCAAGTCTGCCC -3'

Sequencing Primer
(F):5'- ACTGCCATCTCGGTAACAGATGTG -3'
(R):5'- GGGTTCATTCAAGTCTGCCCATTTG -3'
Posted On 2018-05-24