Incidental Mutation 'R6450:Kif2b'
ID 519367
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
MMRRC Submission 044586-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.775) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 91466141-91468384 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 91467192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 364 (V364L)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect probably damaging
Transcript: ENSMUST00000061019
AA Change: V364L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: V364L

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Meta Mutation Damage Score 0.2202 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 119,815,449 (GRCm39) N232K probably benign Het
Acaca T A 11: 84,171,294 (GRCm39) V5E probably damaging Het
Adam18 A T 8: 25,119,691 (GRCm39) D529E probably benign Het
Adgrb3 T C 1: 25,459,683 (GRCm39) T798A probably benign Het
Alyref T C 11: 120,486,872 (GRCm39) T130A probably benign Het
Arhgap24 A G 5: 103,044,990 (GRCm39) S591G probably benign Het
Carmil1 C T 13: 24,220,547 (GRCm39) G655E probably damaging Het
Cdc42bpg T A 19: 6,364,518 (GRCm39) probably null Het
Clec12a T A 6: 129,330,366 (GRCm39) L48H probably damaging Het
Coq2 C A 5: 100,809,770 (GRCm39) probably benign Het
Crb2 C A 2: 37,683,838 (GRCm39) F1113L possibly damaging Het
Ctla4 A T 1: 60,951,872 (GRCm39) M134L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dync2i1 A T 12: 116,210,347 (GRCm39) Y314* probably null Het
Efhb A G 17: 53,759,632 (GRCm39) V290A possibly damaging Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Eva1a A T 6: 82,069,086 (GRCm39) I138F probably damaging Het
Fat2 T A 11: 55,180,136 (GRCm39) I1402F probably damaging Het
Fat3 A T 9: 15,910,466 (GRCm39) H1845Q possibly damaging Het
Gimap8 T A 6: 48,633,385 (GRCm39) F401L probably benign Het
Gpr162 C T 6: 124,838,152 (GRCm39) R166Q possibly damaging Het
H2ac8 A G 13: 23,755,119 (GRCm39) V55A probably damaging Het
Hdac4 G A 1: 91,912,433 (GRCm39) P348S possibly damaging Het
Hmcn2 T C 2: 31,251,812 (GRCm39) V849A probably benign Het
Inpp5b T A 4: 124,686,045 (GRCm39) N696K probably damaging Het
Kdm5d G T Y: 927,056 (GRCm39) R598L probably damaging Homo
Kidins220 T C 12: 25,107,190 (GRCm39) S1548P probably benign Het
Kitl A G 10: 99,923,256 (GRCm39) M1V probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Map6 T C 7: 98,917,245 (GRCm39) I6T probably damaging Het
Mastl T C 2: 23,010,941 (GRCm39) T768A probably damaging Het
Mettl16 T C 11: 74,696,164 (GRCm39) V335A probably benign Het
Mpl T C 4: 118,305,897 (GRCm39) probably null Het
Myo5c C T 9: 75,193,860 (GRCm39) T1205I probably benign Het
Nav2 C A 7: 49,244,114 (GRCm39) L2114I probably damaging Het
Neb T A 2: 52,084,481 (GRCm39) K5330* probably null Het
Nfe2l1 C T 11: 96,718,161 (GRCm39) E125K possibly damaging Het
Onecut3 A G 10: 80,331,922 (GRCm39) K361E probably damaging Het
Or4f47 T A 2: 111,972,725 (GRCm39) L145* probably null Het
Osbpl6 A G 2: 76,395,174 (GRCm39) N370S possibly damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
P2rx4 A G 5: 122,865,304 (GRCm39) T310A possibly damaging Het
Pcdha11 G T 18: 37,146,215 (GRCm39) D769Y probably damaging Het
Pcgf6 C T 19: 47,037,527 (GRCm39) R124H probably benign Het
Pibf1 T A 14: 99,374,646 (GRCm39) Y362N probably damaging Het
Ppm1g T C 5: 31,360,468 (GRCm39) E422G probably benign Het
Prmt8 T C 6: 127,709,606 (GRCm39) I85V possibly damaging Het
Prss27 A T 17: 24,263,988 (GRCm39) K225* probably null Het
Rai1 A T 11: 60,077,429 (GRCm39) T498S probably benign Het
Sbf2 C A 7: 110,062,070 (GRCm39) G23V probably damaging Het
Sdha C T 13: 74,482,412 (GRCm39) probably null Het
Sgo2a C T 1: 58,042,092 (GRCm39) Q140* probably null Het
Sh3rf3 A G 10: 58,819,966 (GRCm39) D259G probably damaging Het
Slc27a3 C A 3: 90,292,777 (GRCm39) D631Y probably damaging Het
Slc7a10 T C 7: 34,886,015 (GRCm39) S37P possibly damaging Het
Slco6d1 A G 1: 98,349,192 (GRCm39) T88A probably benign Het
Smad4 A T 18: 73,810,817 (GRCm39) S56T possibly damaging Het
Smarcd1 A G 15: 99,605,766 (GRCm39) I346V possibly damaging Het
Spast C T 17: 74,675,835 (GRCm39) P260S probably benign Het
Spata31f1e C A 4: 42,792,489 (GRCm39) G548W probably damaging Het
Sprr2i A T 3: 92,316,017 (GRCm39) probably benign Het
Sptbn5 A G 2: 119,877,616 (GRCm39) probably benign Het
Taar9 A T 10: 23,985,138 (GRCm39) Y99N probably damaging Het
Trappc10 A T 10: 78,045,284 (GRCm39) M468K possibly damaging Het
Trim66 T C 7: 109,059,945 (GRCm39) R814G probably benign Het
Tspan31 A G 10: 126,904,227 (GRCm39) C157R probably damaging Het
Vmn2r90 A G 17: 17,953,498 (GRCm39) D554G possibly damaging Het
Vmn2r91 A T 17: 18,305,527 (GRCm39) D70V probably damaging Het
Wdfy4 C T 14: 32,830,649 (GRCm39) G928R probably damaging Het
Zfp346 G T 13: 55,261,517 (GRCm39) K102N probably damaging Het
Zmym4 G A 4: 126,789,099 (GRCm39) P1002S probably damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91,467,206 (GRCm39) missense probably damaging 1.00
IGL01459:Kif2b APN 11 91,467,849 (GRCm39) missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91,467,191 (GRCm39) missense probably damaging 1.00
IGL02897:Kif2b APN 11 91,467,045 (GRCm39) missense probably damaging 1.00
R0076:Kif2b UTSW 11 91,466,735 (GRCm39) missense probably damaging 1.00
R0488:Kif2b UTSW 11 91,467,798 (GRCm39) missense probably benign 0.00
R0524:Kif2b UTSW 11 91,466,550 (GRCm39) missense probably benign 0.00
R0549:Kif2b UTSW 11 91,467,410 (GRCm39) missense probably damaging 1.00
R0893:Kif2b UTSW 11 91,466,420 (GRCm39) missense probably benign 0.16
R1677:Kif2b UTSW 11 91,466,798 (GRCm39) missense probably damaging 1.00
R2025:Kif2b UTSW 11 91,468,172 (GRCm39) missense probably damaging 0.99
R2185:Kif2b UTSW 11 91,467,797 (GRCm39) frame shift probably null
R2290:Kif2b UTSW 11 91,466,522 (GRCm39) missense probably benign 0.00
R4697:Kif2b UTSW 11 91,467,672 (GRCm39) missense probably benign 0.01
R4785:Kif2b UTSW 11 91,467,254 (GRCm39) missense probably benign 0.07
R5429:Kif2b UTSW 11 91,468,055 (GRCm39) missense probably benign 0.03
R5555:Kif2b UTSW 11 91,466,286 (GRCm39) missense probably benign 0.00
R5652:Kif2b UTSW 11 91,466,656 (GRCm39) missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91,468,068 (GRCm39) missense probably benign 0.28
R6101:Kif2b UTSW 11 91,466,814 (GRCm39) missense probably benign 0.00
R6105:Kif2b UTSW 11 91,466,814 (GRCm39) missense probably benign 0.00
R6862:Kif2b UTSW 11 91,466,741 (GRCm39) missense probably damaging 1.00
R7097:Kif2b UTSW 11 91,467,650 (GRCm39) missense probably benign 0.00
R7189:Kif2b UTSW 11 91,467,963 (GRCm39) missense probably benign 0.01
R7507:Kif2b UTSW 11 91,468,269 (GRCm39) missense probably benign
R7742:Kif2b UTSW 11 91,467,411 (GRCm39) missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91,466,952 (GRCm39) missense probably damaging 1.00
R7820:Kif2b UTSW 11 91,468,100 (GRCm39) missense probably benign 0.01
R7946:Kif2b UTSW 11 91,466,571 (GRCm39) missense probably benign 0.00
R8378:Kif2b UTSW 11 91,467,201 (GRCm39) missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91,467,140 (GRCm39) missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91,468,023 (GRCm39) missense probably benign 0.00
R8927:Kif2b UTSW 11 91,468,023 (GRCm39) missense probably benign 0.00
R8969:Kif2b UTSW 11 91,468,019 (GRCm39) missense probably benign 0.00
R9002:Kif2b UTSW 11 91,467,053 (GRCm39) missense probably benign 0.30
R9028:Kif2b UTSW 11 91,468,011 (GRCm39) missense probably benign
R9039:Kif2b UTSW 11 91,467,131 (GRCm39) missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91,466,654 (GRCm39) missense probably damaging 1.00
R9114:Kif2b UTSW 11 91,466,538 (GRCm39) missense possibly damaging 0.77
R9279:Kif2b UTSW 11 91,467,975 (GRCm39) missense probably benign 0.01
Z1176:Kif2b UTSW 11 91,467,090 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTGAGAATGAGCTGGAAC -3'
(R):5'- CAACTTGCTTTGCCTACGG -3'

Sequencing Primer
(F):5'- TGGAACACAGCATGGCTC -3'
(R):5'- TACGGGCAGACTGGCAG -3'
Posted On 2018-05-24