Incidental Mutation 'R6450:Wdfy4'
ID 519375
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 044586-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6450 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32681504-32907465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32830649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 928 (G928R)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061753
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130509
AA Change: G928R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: G928R

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.6063 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 119,815,449 (GRCm39) N232K probably benign Het
Acaca T A 11: 84,171,294 (GRCm39) V5E probably damaging Het
Adam18 A T 8: 25,119,691 (GRCm39) D529E probably benign Het
Adgrb3 T C 1: 25,459,683 (GRCm39) T798A probably benign Het
Alyref T C 11: 120,486,872 (GRCm39) T130A probably benign Het
Arhgap24 A G 5: 103,044,990 (GRCm39) S591G probably benign Het
Carmil1 C T 13: 24,220,547 (GRCm39) G655E probably damaging Het
Cdc42bpg T A 19: 6,364,518 (GRCm39) probably null Het
Clec12a T A 6: 129,330,366 (GRCm39) L48H probably damaging Het
Coq2 C A 5: 100,809,770 (GRCm39) probably benign Het
Crb2 C A 2: 37,683,838 (GRCm39) F1113L possibly damaging Het
Ctla4 A T 1: 60,951,872 (GRCm39) M134L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dync2i1 A T 12: 116,210,347 (GRCm39) Y314* probably null Het
Efhb A G 17: 53,759,632 (GRCm39) V290A possibly damaging Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Eva1a A T 6: 82,069,086 (GRCm39) I138F probably damaging Het
Fat2 T A 11: 55,180,136 (GRCm39) I1402F probably damaging Het
Fat3 A T 9: 15,910,466 (GRCm39) H1845Q possibly damaging Het
Gimap8 T A 6: 48,633,385 (GRCm39) F401L probably benign Het
Gpr162 C T 6: 124,838,152 (GRCm39) R166Q possibly damaging Het
H2ac8 A G 13: 23,755,119 (GRCm39) V55A probably damaging Het
Hdac4 G A 1: 91,912,433 (GRCm39) P348S possibly damaging Het
Hmcn2 T C 2: 31,251,812 (GRCm39) V849A probably benign Het
Inpp5b T A 4: 124,686,045 (GRCm39) N696K probably damaging Het
Kdm5d G T Y: 927,056 (GRCm39) R598L probably damaging Homo
Kidins220 T C 12: 25,107,190 (GRCm39) S1548P probably benign Het
Kif2b C A 11: 91,467,192 (GRCm39) V364L probably damaging Het
Kitl A G 10: 99,923,256 (GRCm39) M1V probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Map6 T C 7: 98,917,245 (GRCm39) I6T probably damaging Het
Mastl T C 2: 23,010,941 (GRCm39) T768A probably damaging Het
Mettl16 T C 11: 74,696,164 (GRCm39) V335A probably benign Het
Mpl T C 4: 118,305,897 (GRCm39) probably null Het
Myo5c C T 9: 75,193,860 (GRCm39) T1205I probably benign Het
Nav2 C A 7: 49,244,114 (GRCm39) L2114I probably damaging Het
Neb T A 2: 52,084,481 (GRCm39) K5330* probably null Het
Nfe2l1 C T 11: 96,718,161 (GRCm39) E125K possibly damaging Het
Onecut3 A G 10: 80,331,922 (GRCm39) K361E probably damaging Het
Or4f47 T A 2: 111,972,725 (GRCm39) L145* probably null Het
Osbpl6 A G 2: 76,395,174 (GRCm39) N370S possibly damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
P2rx4 A G 5: 122,865,304 (GRCm39) T310A possibly damaging Het
Pcdha11 G T 18: 37,146,215 (GRCm39) D769Y probably damaging Het
Pcgf6 C T 19: 47,037,527 (GRCm39) R124H probably benign Het
Pibf1 T A 14: 99,374,646 (GRCm39) Y362N probably damaging Het
Ppm1g T C 5: 31,360,468 (GRCm39) E422G probably benign Het
Prmt8 T C 6: 127,709,606 (GRCm39) I85V possibly damaging Het
Prss27 A T 17: 24,263,988 (GRCm39) K225* probably null Het
Rai1 A T 11: 60,077,429 (GRCm39) T498S probably benign Het
Sbf2 C A 7: 110,062,070 (GRCm39) G23V probably damaging Het
Sdha C T 13: 74,482,412 (GRCm39) probably null Het
Sgo2a C T 1: 58,042,092 (GRCm39) Q140* probably null Het
Sh3rf3 A G 10: 58,819,966 (GRCm39) D259G probably damaging Het
Slc27a3 C A 3: 90,292,777 (GRCm39) D631Y probably damaging Het
Slc7a10 T C 7: 34,886,015 (GRCm39) S37P possibly damaging Het
Slco6d1 A G 1: 98,349,192 (GRCm39) T88A probably benign Het
Smad4 A T 18: 73,810,817 (GRCm39) S56T possibly damaging Het
Smarcd1 A G 15: 99,605,766 (GRCm39) I346V possibly damaging Het
Spast C T 17: 74,675,835 (GRCm39) P260S probably benign Het
Spata31f1e C A 4: 42,792,489 (GRCm39) G548W probably damaging Het
Sprr2i A T 3: 92,316,017 (GRCm39) probably benign Het
Sptbn5 A G 2: 119,877,616 (GRCm39) probably benign Het
Taar9 A T 10: 23,985,138 (GRCm39) Y99N probably damaging Het
Trappc10 A T 10: 78,045,284 (GRCm39) M468K possibly damaging Het
Trim66 T C 7: 109,059,945 (GRCm39) R814G probably benign Het
Tspan31 A G 10: 126,904,227 (GRCm39) C157R probably damaging Het
Vmn2r90 A G 17: 17,953,498 (GRCm39) D554G possibly damaging Het
Vmn2r91 A T 17: 18,305,527 (GRCm39) D70V probably damaging Het
Zfp346 G T 13: 55,261,517 (GRCm39) K102N probably damaging Het
Zmym4 G A 4: 126,789,099 (GRCm39) P1002S probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 32,824,496 (GRCm39) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,681,934 (GRCm39) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 32,825,994 (GRCm39) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 32,873,618 (GRCm39) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 32,742,195 (GRCm39) splice site probably benign
IGL01931:Wdfy4 APN 14 32,877,710 (GRCm39) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 32,855,673 (GRCm39) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 32,798,437 (GRCm39) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 32,815,257 (GRCm39) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 32,871,523 (GRCm39) missense probably benign
IGL02468:Wdfy4 APN 14 32,688,389 (GRCm39) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 32,764,448 (GRCm39) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 32,812,818 (GRCm39) nonsense probably null
IGL02752:Wdfy4 APN 14 32,798,283 (GRCm39) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 32,817,262 (GRCm39) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,693,707 (GRCm39) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 32,831,607 (GRCm39) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 32,798,241 (GRCm39) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 32,862,608 (GRCm39) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,688,392 (GRCm39) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 32,884,827 (GRCm39) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 32,847,844 (GRCm39) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,699,124 (GRCm39) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 32,790,861 (GRCm39) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 32,769,247 (GRCm39) missense probably benign 0.14
dodgers UTSW 14 32,699,063 (GRCm39) nonsense probably null
Dollar UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
Giants UTSW 14 32,792,575 (GRCm39) nonsense probably null
gigantea UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
kings_canyon UTSW 14 32,831,476 (GRCm39) nonsense probably null
moro UTSW 14 32,686,583 (GRCm39) splice site probably null
popped UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
sequoia UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
Sherman UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
stretched UTSW 14 32,795,492 (GRCm39) nonsense probably null
watchtower UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 32,829,130 (GRCm39) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 32,884,708 (GRCm39) missense probably null 1.00
R0085:Wdfy4 UTSW 14 32,800,200 (GRCm39) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 32,805,742 (GRCm39) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 32,805,769 (GRCm39) splice site probably benign
R0496:Wdfy4 UTSW 14 32,862,695 (GRCm39) splice site probably benign
R0514:Wdfy4 UTSW 14 32,802,732 (GRCm39) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 32,764,578 (GRCm39) missense probably benign
R0590:Wdfy4 UTSW 14 32,763,131 (GRCm39) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 32,831,656 (GRCm39) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 32,862,569 (GRCm39) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 32,801,923 (GRCm39) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,693,695 (GRCm39) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,693,729 (GRCm39) splice site probably null
R1415:Wdfy4 UTSW 14 32,763,137 (GRCm39) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 32,830,645 (GRCm39) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 32,822,923 (GRCm39) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 32,874,495 (GRCm39) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,682,765 (GRCm39) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,681,918 (GRCm39) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 32,795,542 (GRCm39) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 32,817,962 (GRCm39) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 32,825,940 (GRCm39) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 32,855,301 (GRCm39) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,693,641 (GRCm39) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 32,828,001 (GRCm39) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 32,868,946 (GRCm39) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 32,795,468 (GRCm39) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 32,884,764 (GRCm39) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R2889:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R3114:Wdfy4 UTSW 14 32,811,860 (GRCm39) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 32,862,602 (GRCm39) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,688,352 (GRCm39) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 32,824,637 (GRCm39) splice site probably benign
R4091:Wdfy4 UTSW 14 32,847,837 (GRCm39) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 32,818,040 (GRCm39) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 32,809,912 (GRCm39) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,711,893 (GRCm39) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 32,831,505 (GRCm39) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 32,867,273 (GRCm39) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,710,852 (GRCm39) nonsense probably null
R4894:Wdfy4 UTSW 14 32,877,717 (GRCm39) missense probably benign 0.03
R4929:Wdfy4 UTSW 14 32,769,213 (GRCm39) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 32,750,970 (GRCm39) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 32,822,897 (GRCm39) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 32,801,892 (GRCm39) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 32,874,627 (GRCm39) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 32,769,232 (GRCm39) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 32,800,300 (GRCm39) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 32,812,823 (GRCm39) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,710,856 (GRCm39) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,681,959 (GRCm39) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 32,873,689 (GRCm39) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 32,829,087 (GRCm39) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 32,855,454 (GRCm39) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
R5890:Wdfy4 UTSW 14 32,824,534 (GRCm39) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 32,855,317 (GRCm39) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 32,827,968 (GRCm39) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,693,668 (GRCm39) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 32,831,482 (GRCm39) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 32,823,006 (GRCm39) nonsense probably null
R6370:Wdfy4 UTSW 14 32,790,807 (GRCm39) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 32,826,051 (GRCm39) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,689,604 (GRCm39) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 32,868,901 (GRCm39) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 32,769,208 (GRCm39) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,681,923 (GRCm39) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 32,821,074 (GRCm39) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,686,583 (GRCm39) splice site probably null
R7101:Wdfy4 UTSW 14 32,682,777 (GRCm39) missense
R7114:Wdfy4 UTSW 14 32,693,531 (GRCm39) splice site probably null
R7139:Wdfy4 UTSW 14 32,873,535 (GRCm39) missense
R7255:Wdfy4 UTSW 14 32,696,239 (GRCm39) missense
R7324:Wdfy4 UTSW 14 32,769,271 (GRCm39) missense
R7379:Wdfy4 UTSW 14 32,873,566 (GRCm39) missense
R7399:Wdfy4 UTSW 14 32,790,863 (GRCm39) missense
R7408:Wdfy4 UTSW 14 32,800,264 (GRCm39) missense
R7410:Wdfy4 UTSW 14 32,696,191 (GRCm39) missense
R7411:Wdfy4 UTSW 14 32,828,088 (GRCm39) missense
R7412:Wdfy4 UTSW 14 32,871,541 (GRCm39) missense
R7445:Wdfy4 UTSW 14 32,792,575 (GRCm39) nonsense probably null
R7595:Wdfy4 UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,707,696 (GRCm39) missense
R7622:Wdfy4 UTSW 14 32,800,231 (GRCm39) missense
R7828:Wdfy4 UTSW 14 32,710,878 (GRCm39) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 32,812,920 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,792,705 (GRCm39) missense
R7986:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7990:Wdfy4 UTSW 14 32,819,752 (GRCm39) missense
R8001:Wdfy4 UTSW 14 32,695,492 (GRCm39) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,693,584 (GRCm39) missense
R8015:Wdfy4 UTSW 14 32,829,704 (GRCm39) missense
R8032:Wdfy4 UTSW 14 32,751,043 (GRCm39) nonsense probably null
R8041:Wdfy4 UTSW 14 32,875,965 (GRCm39) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8092:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8112:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8114:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8115:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,699,063 (GRCm39) nonsense probably null
R8118:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8140:Wdfy4 UTSW 14 32,864,317 (GRCm39) missense
R8155:Wdfy4 UTSW 14 32,884,776 (GRCm39) missense
R8163:Wdfy4 UTSW 14 32,873,545 (GRCm39) missense
R8293:Wdfy4 UTSW 14 32,696,218 (GRCm39) missense
R8325:Wdfy4 UTSW 14 32,689,444 (GRCm39) missense
R8353:Wdfy4 UTSW 14 32,695,581 (GRCm39) missense probably benign
R8370:Wdfy4 UTSW 14 32,815,208 (GRCm39) missense
R8437:Wdfy4 UTSW 14 32,798,332 (GRCm39) missense
R8497:Wdfy4 UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 32,800,258 (GRCm39) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,693,722 (GRCm39) splice site probably benign
R8708:Wdfy4 UTSW 14 32,689,489 (GRCm39) missense
R8747:Wdfy4 UTSW 14 32,874,611 (GRCm39) missense
R8794:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 32,867,105 (GRCm39) missense
R8880:Wdfy4 UTSW 14 32,795,492 (GRCm39) nonsense probably null
R9109:Wdfy4 UTSW 14 32,760,704 (GRCm39) splice site probably null
R9131:Wdfy4 UTSW 14 32,819,807 (GRCm39) missense
R9309:Wdfy4 UTSW 14 32,817,313 (GRCm39) missense
R9349:Wdfy4 UTSW 14 32,875,996 (GRCm39) missense
R9451:Wdfy4 UTSW 14 32,855,518 (GRCm39) missense
R9563:Wdfy4 UTSW 14 32,692,833 (GRCm39) missense
R9587:Wdfy4 UTSW 14 32,769,230 (GRCm39) nonsense probably null
R9599:Wdfy4 UTSW 14 32,855,428 (GRCm39) missense
R9670:Wdfy4 UTSW 14 32,769,219 (GRCm39) missense
R9718:Wdfy4 UTSW 14 32,847,893 (GRCm39) missense
R9742:Wdfy4 UTSW 14 32,809,987 (GRCm39) missense
X0028:Wdfy4 UTSW 14 32,802,593 (GRCm39) missense probably benign
X0053:Wdfy4 UTSW 14 32,884,899 (GRCm39) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
Z1177:Wdfy4 UTSW 14 32,809,942 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ACCCCTATCTCCATGACTGAGC -3'
(R):5'- CCCAGCTTCATTAACTCTGAGC -3'

Sequencing Primer
(F):5'- GGAAAACACGCCTGCTCATTTTC -3'
(R):5'- CAGCTTCATTAACTCTGAGCTGGAG -3'
Posted On 2018-05-24