Incidental Mutation 'R6452:Zfp442'
ID 519392
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission 044588-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6452 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150249061-150293406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 150250028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 568 (H568Y)
Ref Sequence ENSEMBL: ENSMUSP00000140098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect probably benign
Transcript: ENSMUST00000109916
AA Change: H625Y

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: H625Y

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: H568Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: H568Y

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A G 13: 119,624,651 (GRCm39) probably benign Het
Alox12e A T 11: 70,210,831 (GRCm39) V296E probably damaging Het
Bmal2 G A 6: 146,724,705 (GRCm39) E400K probably benign Het
Ccdc171 A G 4: 83,782,527 (GRCm39) D1273G probably damaging Het
Cetn3 C T 13: 81,932,797 (GRCm39) R19* probably null Het
Chd6 G T 2: 160,807,418 (GRCm39) P1932H possibly damaging Het
Cimip1 C A 2: 173,369,700 (GRCm39) F71L probably benign Het
Cyp2d34 A T 15: 82,500,290 (GRCm39) I483N probably benign Het
Dglucy T C 12: 100,801,468 (GRCm39) V71A possibly damaging Het
Dhx35 A G 2: 158,673,607 (GRCm39) E346G probably damaging Het
Dnajc14 A G 10: 128,643,359 (GRCm39) E427G probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fasn G T 11: 120,706,237 (GRCm39) Q1036K probably damaging Het
Fermt3 A T 19: 6,992,105 (GRCm39) F92I probably benign Het
Filip1l C A 16: 57,327,163 (GRCm39) D64E possibly damaging Het
Fnbp1l A G 3: 122,338,198 (GRCm39) F491S probably damaging Het
Fzd2 T G 11: 102,495,811 (GRCm39) V85G probably damaging Het
Gjd4 G A 18: 9,280,457 (GRCm39) T207M possibly damaging Het
Gm32742 T C 9: 51,057,490 (GRCm39) E1096G probably damaging Het
Itgb3 T A 11: 104,524,290 (GRCm39) L142* probably null Het
Kctd21 T A 7: 96,996,869 (GRCm39) I114N probably benign Het
Klra4 G T 6: 130,042,329 (GRCm39) probably null Het
Larp4b T C 13: 9,197,503 (GRCm39) V240A probably damaging Het
Lrriq4 T C 3: 30,709,882 (GRCm39) S409P probably damaging Het
Magel2 A G 7: 62,030,132 (GRCm39) E1012G unknown Het
Mmp24 A T 2: 155,657,673 (GRCm39) D521V possibly damaging Het
Mocos A G 18: 24,828,998 (GRCm39) I768V probably benign Het
Mprip A T 11: 59,643,609 (GRCm39) E553V probably damaging Het
Myh8 A T 11: 67,196,565 (GRCm39) I1762F possibly damaging Het
Myh8 A T 11: 67,183,275 (GRCm39) Y718F probably benign Het
Myo7a C T 7: 97,722,374 (GRCm39) V1184M probably benign Het
Neb A T 2: 52,069,495 (GRCm39) D5775E probably benign Het
Or10h5 T C 17: 33,434,919 (GRCm39) N133S probably benign Het
Or5p66 A G 7: 107,886,100 (GRCm39) S78P probably damaging Het
Pramel19 T C 4: 101,798,640 (GRCm39) Y204H probably benign Het
Prl8a2 T C 13: 27,536,780 (GRCm39) I134T probably benign Het
Qrich2 G A 11: 116,346,714 (GRCm39) T1370I probably benign Het
Rabgap1l A G 1: 160,281,331 (GRCm39) L630P probably damaging Het
Ranbp2 G T 10: 58,313,979 (GRCm39) L1566F probably benign Het
Rnf43 T A 11: 87,623,079 (GRCm39) W727R probably damaging Het
Rundc3b A T 5: 8,629,175 (GRCm39) probably null Het
Samm50 T G 15: 84,088,298 (GRCm39) probably benign Het
Sema4f G A 6: 82,894,643 (GRCm39) A476V probably benign Het
Slc4a4 A G 5: 89,376,839 (GRCm39) N1031S probably benign Het
Slc4a9 A G 18: 36,664,512 (GRCm39) Y390C probably damaging Het
Slco6d1 C A 1: 98,348,937 (GRCm39) Q3K probably benign Het
Smim1 T C 4: 154,108,071 (GRCm39) probably benign Het
Spg7 A G 8: 123,806,162 (GRCm39) K291E possibly damaging Het
Sppl2c A T 11: 104,079,017 (GRCm39) T606S probably benign Het
Tex15 A G 8: 34,062,844 (GRCm39) D758G probably damaging Het
Tigd5 A T 15: 75,783,287 (GRCm39) R550* probably null Het
Tlcd3a G T 11: 76,097,972 (GRCm39) G60* probably null Het
Tnrc18 A C 5: 142,712,767 (GRCm39) L2594R probably damaging Het
Vezf1 A G 11: 87,972,496 (GRCm39) T468A possibly damaging Het
Vmn1r210 T A 13: 23,011,840 (GRCm39) I149F probably damaging Het
Vmn2r96 A C 17: 18,804,117 (GRCm39) T264P probably benign Het
Zfp217 C G 2: 169,961,214 (GRCm39) S371T probably benign Het
Zfp53 A C 17: 21,729,875 (GRCm39) H636P probably damaging Het
Zscan4d C T 7: 10,895,999 (GRCm39) C457Y probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150,251,267 (GRCm39) nonsense probably null
IGL02566:Zfp442 APN 2 150,251,711 (GRCm39) critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150,251,714 (GRCm39) splice site probably benign
LCD18:Zfp442 UTSW 2 150,261,768 (GRCm39) intron probably benign
PIT4812001:Zfp442 UTSW 2 150,251,661 (GRCm39) nonsense probably null
R0219:Zfp442 UTSW 2 150,253,160 (GRCm39) missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150,253,169 (GRCm39) missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150,250,260 (GRCm39) nonsense probably null
R1702:Zfp442 UTSW 2 150,251,100 (GRCm39) nonsense probably null
R1829:Zfp442 UTSW 2 150,250,983 (GRCm39) missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150,250,100 (GRCm39) missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150,250,582 (GRCm39) missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150,250,042 (GRCm39) missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150,251,526 (GRCm39) missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150,250,149 (GRCm39) missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150,253,130 (GRCm39) critical splice donor site probably null
R4932:Zfp442 UTSW 2 150,251,635 (GRCm39) missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150,250,415 (GRCm39) missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150,251,530 (GRCm39) missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150,250,079 (GRCm39) missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150,249,944 (GRCm39) nonsense probably null
R6042:Zfp442 UTSW 2 150,250,016 (GRCm39) missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150,293,321 (GRCm39) critical splice donor site probably null
R6787:Zfp442 UTSW 2 150,251,499 (GRCm39) missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150,252,860 (GRCm39) critical splice donor site probably null
R7061:Zfp442 UTSW 2 150,249,937 (GRCm39) missense probably benign 0.33
R7184:Zfp442 UTSW 2 150,250,056 (GRCm39) missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150,251,201 (GRCm39) missense probably benign 0.04
R7225:Zfp442 UTSW 2 150,250,925 (GRCm39) missense probably benign 0.00
R7513:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R7591:Zfp442 UTSW 2 150,250,092 (GRCm39) nonsense probably null
R7679:Zfp442 UTSW 2 150,252,917 (GRCm39) nonsense probably null
R7768:Zfp442 UTSW 2 150,250,241 (GRCm39) missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150,251,639 (GRCm39) missense probably benign 0.28
R7814:Zfp442 UTSW 2 150,251,402 (GRCm39) missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150,253,146 (GRCm39) missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150,251,096 (GRCm39) missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150,250,629 (GRCm39) missense unknown
R8528:Zfp442 UTSW 2 150,250,962 (GRCm39) missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150,250,093 (GRCm39) missense probably benign 0.30
R9269:Zfp442 UTSW 2 150,251,287 (GRCm39) missense probably benign 0.19
R9371:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R9401:Zfp442 UTSW 2 150,251,615 (GRCm39) missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150,250,668 (GRCm39) missense unknown
R9711:Zfp442 UTSW 2 150,250,207 (GRCm39) missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150,250,399 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATAGAAATGTACAAAGGCTTCAC -3'
(R):5'- GGTAAAGCGTTTGTACTTCACAG -3'

Sequencing Primer
(F):5'- gggtttctctcctgtatgtg -3'
(R):5'- AGCGTTTGTACTTCACAGTTATC -3'
Posted On 2018-05-24