Incidental Mutation 'R6452:Zfp442'
ID519392
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150408108 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 568 (H568Y)
Ref Sequence ENSEMBL: ENSMUSP00000140098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect probably benign
Transcript: ENSMUST00000109916
AA Change: H625Y

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: H625Y

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: H568Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: H568Y

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATAGAAATGTACAAAGGCTTCAC -3'
(R):5'- GGTAAAGCGTTTGTACTTCACAG -3'

Sequencing Primer
(F):5'- gggtttctctcctgtatgtg -3'
(R):5'- AGCGTTTGTACTTCACAGTTATC -3'
Posted On2018-05-24