Incidental Mutation 'R6452:Dnajc14'
ID519418
Institutional Source Beutler Lab
Gene Symbol Dnajc14
Ensembl Gene ENSMUSG00000025354
Gene NameDnaJ heat shock protein family (Hsp40) member C14
SynonymsDRIP78, LIP6, HDJ3, 5730551F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6452 (G1)
Quality Score179.009
Status Not validated
Chromosome10
Chromosomal Location128804062-128819446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128807490 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 427 (E427G)
Ref Sequence ENSEMBL: ENSMUSP00000151343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026410] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000217745] [ENSMUST00000218001] [ENSMUST00000218511] [ENSMUST00000219508]
Predicted Effect probably damaging
Transcript: ENSMUST00000026410
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354
AA Change: E427G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051011
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217745
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218001
Predicted Effect probably benign
Transcript: ENSMUST00000218511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably damaging
Transcript: ENSMUST00000219508
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1645 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Dnajc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Dnajc14 APN 10 128806332 missense probably damaging 1.00
IGL00924:Dnajc14 APN 10 128817319 missense probably benign
IGL00943:Dnajc14 APN 10 128816806 missense possibly damaging 0.92
IGL02833:Dnajc14 APN 10 128806599 missense possibly damaging 0.94
IGL02799:Dnajc14 UTSW 10 128806856 missense possibly damaging 0.88
PIT4812001:Dnajc14 UTSW 10 128806683 missense probably damaging 0.96
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R1932:Dnajc14 UTSW 10 128816792 missense probably damaging 1.00
R4412:Dnajc14 UTSW 10 128806205 start gained probably benign
R4717:Dnajc14 UTSW 10 128806244 missense possibly damaging 0.92
R4804:Dnajc14 UTSW 10 128814057 missense probably benign 0.06
R4870:Dnajc14 UTSW 10 128817350 missense probably benign 0.00
R6323:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6325:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6399:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6400:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6453:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6556:Dnajc14 UTSW 10 128814631 missense probably benign 0.42
R6847:Dnajc14 UTSW 10 128816787 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTCTTGGCTGGGTTCTCCA -3'
(R):5'- AGGAAATCCTTCACCTTCCCT -3'

Sequencing Primer
(F):5'- GGGTTCTCCAGCCTTGC -3'
(R):5'- TTGACTCTACACTCCCTAAAAACTGG -3'
Posted On2018-05-24