Incidental Mutation 'R6452:Myh8'
ID 519420
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, MyHC-pn, Myhs-p, 4832426G23Rik
MMRRC Submission 044588-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R6452 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67167950-67199460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67183275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 718 (Y718F)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
AlphaFold P13542
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: Y718F

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: Y718F

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A G 13: 119,624,651 (GRCm39) probably benign Het
Alox12e A T 11: 70,210,831 (GRCm39) V296E probably damaging Het
Bmal2 G A 6: 146,724,705 (GRCm39) E400K probably benign Het
Ccdc171 A G 4: 83,782,527 (GRCm39) D1273G probably damaging Het
Cetn3 C T 13: 81,932,797 (GRCm39) R19* probably null Het
Chd6 G T 2: 160,807,418 (GRCm39) P1932H possibly damaging Het
Cimip1 C A 2: 173,369,700 (GRCm39) F71L probably benign Het
Cyp2d34 A T 15: 82,500,290 (GRCm39) I483N probably benign Het
Dglucy T C 12: 100,801,468 (GRCm39) V71A possibly damaging Het
Dhx35 A G 2: 158,673,607 (GRCm39) E346G probably damaging Het
Dnajc14 A G 10: 128,643,359 (GRCm39) E427G probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fasn G T 11: 120,706,237 (GRCm39) Q1036K probably damaging Het
Fermt3 A T 19: 6,992,105 (GRCm39) F92I probably benign Het
Filip1l C A 16: 57,327,163 (GRCm39) D64E possibly damaging Het
Fnbp1l A G 3: 122,338,198 (GRCm39) F491S probably damaging Het
Fzd2 T G 11: 102,495,811 (GRCm39) V85G probably damaging Het
Gjd4 G A 18: 9,280,457 (GRCm39) T207M possibly damaging Het
Gm32742 T C 9: 51,057,490 (GRCm39) E1096G probably damaging Het
Itgb3 T A 11: 104,524,290 (GRCm39) L142* probably null Het
Kctd21 T A 7: 96,996,869 (GRCm39) I114N probably benign Het
Klra4 G T 6: 130,042,329 (GRCm39) probably null Het
Larp4b T C 13: 9,197,503 (GRCm39) V240A probably damaging Het
Lrriq4 T C 3: 30,709,882 (GRCm39) S409P probably damaging Het
Magel2 A G 7: 62,030,132 (GRCm39) E1012G unknown Het
Mmp24 A T 2: 155,657,673 (GRCm39) D521V possibly damaging Het
Mocos A G 18: 24,828,998 (GRCm39) I768V probably benign Het
Mprip A T 11: 59,643,609 (GRCm39) E553V probably damaging Het
Myo7a C T 7: 97,722,374 (GRCm39) V1184M probably benign Het
Neb A T 2: 52,069,495 (GRCm39) D5775E probably benign Het
Or10h5 T C 17: 33,434,919 (GRCm39) N133S probably benign Het
Or5p66 A G 7: 107,886,100 (GRCm39) S78P probably damaging Het
Pramel19 T C 4: 101,798,640 (GRCm39) Y204H probably benign Het
Prl8a2 T C 13: 27,536,780 (GRCm39) I134T probably benign Het
Qrich2 G A 11: 116,346,714 (GRCm39) T1370I probably benign Het
Rabgap1l A G 1: 160,281,331 (GRCm39) L630P probably damaging Het
Ranbp2 G T 10: 58,313,979 (GRCm39) L1566F probably benign Het
Rnf43 T A 11: 87,623,079 (GRCm39) W727R probably damaging Het
Rundc3b A T 5: 8,629,175 (GRCm39) probably null Het
Samm50 T G 15: 84,088,298 (GRCm39) probably benign Het
Sema4f G A 6: 82,894,643 (GRCm39) A476V probably benign Het
Slc4a4 A G 5: 89,376,839 (GRCm39) N1031S probably benign Het
Slc4a9 A G 18: 36,664,512 (GRCm39) Y390C probably damaging Het
Slco6d1 C A 1: 98,348,937 (GRCm39) Q3K probably benign Het
Smim1 T C 4: 154,108,071 (GRCm39) probably benign Het
Spg7 A G 8: 123,806,162 (GRCm39) K291E possibly damaging Het
Sppl2c A T 11: 104,079,017 (GRCm39) T606S probably benign Het
Tex15 A G 8: 34,062,844 (GRCm39) D758G probably damaging Het
Tigd5 A T 15: 75,783,287 (GRCm39) R550* probably null Het
Tlcd3a G T 11: 76,097,972 (GRCm39) G60* probably null Het
Tnrc18 A C 5: 142,712,767 (GRCm39) L2594R probably damaging Het
Vezf1 A G 11: 87,972,496 (GRCm39) T468A possibly damaging Het
Vmn1r210 T A 13: 23,011,840 (GRCm39) I149F probably damaging Het
Vmn2r96 A C 17: 18,804,117 (GRCm39) T264P probably benign Het
Zfp217 C G 2: 169,961,214 (GRCm39) S371T probably benign Het
Zfp442 G A 2: 150,250,028 (GRCm39) H568Y probably damaging Het
Zfp53 A C 17: 21,729,875 (GRCm39) H636P probably damaging Het
Zscan4d C T 7: 10,895,999 (GRCm39) C457Y probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL01020:Myh8 APN 11 67,174,229 (GRCm39) missense probably damaging 0.99
IGL01348:Myh8 APN 11 67,188,606 (GRCm39) missense probably damaging 1.00
IGL01382:Myh8 APN 11 67,192,799 (GRCm39) missense probably damaging 1.00
IGL01454:Myh8 APN 11 67,174,422 (GRCm39) missense probably damaging 1.00
IGL01457:Myh8 APN 11 67,183,505 (GRCm39) missense probably benign 0.00
IGL01472:Myh8 APN 11 67,179,205 (GRCm39) splice site probably benign
IGL01473:Myh8 APN 11 67,192,651 (GRCm39) critical splice donor site probably null
IGL01613:Myh8 APN 11 67,192,536 (GRCm39) missense probably benign 0.11
IGL01763:Myh8 APN 11 67,177,245 (GRCm39) missense probably benign 0.01
IGL01828:Myh8 APN 11 67,194,652 (GRCm39) missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67,180,520 (GRCm39) nonsense probably null
IGL01905:Myh8 APN 11 67,175,477 (GRCm39) missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67,174,198 (GRCm39) unclassified probably benign
IGL02386:Myh8 APN 11 67,185,266 (GRCm39) missense probably damaging 0.99
IGL02449:Myh8 APN 11 67,185,440 (GRCm39) critical splice donor site probably null
IGL02500:Myh8 APN 11 67,196,536 (GRCm39) missense probably benign 0.00
IGL02745:Myh8 APN 11 67,188,327 (GRCm39) missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67,192,418 (GRCm39) splice site probably benign
IGL03063:Myh8 APN 11 67,179,031 (GRCm39) missense probably benign 0.00
IGL03223:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL03336:Myh8 APN 11 67,175,528 (GRCm39) missense probably damaging 1.00
IGL03338:Myh8 APN 11 67,189,172 (GRCm39) missense probably damaging 1.00
IGL03351:Myh8 APN 11 67,194,739 (GRCm39) missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67,185,244 (GRCm39) missense probably damaging 1.00
BB003:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
BB013:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67,180,456 (GRCm39) missense probably benign 0.01
R0012:Myh8 UTSW 11 67,190,847 (GRCm39) missense probably benign 0.02
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0115:Myh8 UTSW 11 67,197,090 (GRCm39) splice site probably benign
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0132:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0393:Myh8 UTSW 11 67,196,843 (GRCm39) splice site probably benign
R0453:Myh8 UTSW 11 67,183,731 (GRCm39) missense probably benign 0.03
R0454:Myh8 UTSW 11 67,194,591 (GRCm39) nonsense probably null
R0466:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R0487:Myh8 UTSW 11 67,192,837 (GRCm39) missense probably benign
R0511:Myh8 UTSW 11 67,175,333 (GRCm39) missense probably benign 0.01
R0557:Myh8 UTSW 11 67,192,624 (GRCm39) missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67,189,453 (GRCm39) missense probably benign 0.00
R0658:Myh8 UTSW 11 67,175,358 (GRCm39) critical splice donor site probably null
R0782:Myh8 UTSW 11 67,180,580 (GRCm39) missense probably benign 0.16
R0829:Myh8 UTSW 11 67,174,326 (GRCm39) unclassified probably benign
R0845:Myh8 UTSW 11 67,177,090 (GRCm39) missense probably damaging 1.00
R0930:Myh8 UTSW 11 67,196,824 (GRCm39) missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67,188,585 (GRCm39) missense probably damaging 1.00
R1132:Myh8 UTSW 11 67,187,957 (GRCm39) nonsense probably null
R1417:Myh8 UTSW 11 67,197,011 (GRCm39) missense probably damaging 1.00
R1478:Myh8 UTSW 11 67,183,551 (GRCm39) missense probably benign 0.23
R1497:Myh8 UTSW 11 67,180,638 (GRCm39) missense probably benign 0.00
R1605:Myh8 UTSW 11 67,192,497 (GRCm39) missense probably damaging 0.99
R1701:Myh8 UTSW 11 67,170,964 (GRCm39) missense probably damaging 1.00
R1950:Myh8 UTSW 11 67,169,830 (GRCm39) missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67,183,550 (GRCm39) missense probably benign 0.00
R2010:Myh8 UTSW 11 67,187,990 (GRCm39) nonsense probably null
R2095:Myh8 UTSW 11 67,177,050 (GRCm39) missense probably benign 0.00
R2132:Myh8 UTSW 11 67,183,702 (GRCm39) missense probably damaging 1.00
R2152:Myh8 UTSW 11 67,185,295 (GRCm39) missense probably damaging 0.97
R2229:Myh8 UTSW 11 67,199,174 (GRCm39) missense probably damaging 0.98
R2302:Myh8 UTSW 11 67,177,065 (GRCm39) missense probably damaging 1.00
R2364:Myh8 UTSW 11 67,185,344 (GRCm39) missense probably benign 0.03
R2429:Myh8 UTSW 11 67,194,723 (GRCm39) missense probably benign 0.21
R2880:Myh8 UTSW 11 67,188,090 (GRCm39) missense probably damaging 0.97
R3692:Myh8 UTSW 11 67,192,744 (GRCm39) missense probably damaging 0.98
R3756:Myh8 UTSW 11 67,175,443 (GRCm39) unclassified probably benign
R3924:Myh8 UTSW 11 67,187,963 (GRCm39) missense probably damaging 0.99
R4172:Myh8 UTSW 11 67,183,247 (GRCm39) missense probably damaging 1.00
R4255:Myh8 UTSW 11 67,190,560 (GRCm39) missense probably benign
R4621:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4623:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4790:Myh8 UTSW 11 67,170,789 (GRCm39) missense probably damaging 0.99
R4914:Myh8 UTSW 11 67,183,510 (GRCm39) missense probably damaging 1.00
R5074:Myh8 UTSW 11 67,196,742 (GRCm39) missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67,189,184 (GRCm39) missense probably damaging 1.00
R5159:Myh8 UTSW 11 67,179,179 (GRCm39) missense probably damaging 0.99
R5229:Myh8 UTSW 11 67,175,310 (GRCm39) missense probably damaging 0.96
R5320:Myh8 UTSW 11 67,177,089 (GRCm39) missense probably damaging 1.00
R5455:Myh8 UTSW 11 67,192,244 (GRCm39) missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67,196,788 (GRCm39) missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67,177,266 (GRCm39) missense probably benign 0.00
R5726:Myh8 UTSW 11 67,185,392 (GRCm39) missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67,188,026 (GRCm39) missense probably damaging 1.00
R6135:Myh8 UTSW 11 67,188,326 (GRCm39) missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67,192,793 (GRCm39) missense probably benign 0.06
R6318:Myh8 UTSW 11 67,190,167 (GRCm39) missense probably benign 0.00
R6432:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R6452:Myh8 UTSW 11 67,196,565 (GRCm39) missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67,180,488 (GRCm39) nonsense probably null
R6714:Myh8 UTSW 11 67,197,775 (GRCm39) missense probably damaging 1.00
R6842:Myh8 UTSW 11 67,175,481 (GRCm39) missense probably damaging 1.00
R7007:Myh8 UTSW 11 67,179,142 (GRCm39) missense probably benign 0.03
R7025:Myh8 UTSW 11 67,188,365 (GRCm39) missense probably benign 0.02
R7086:Myh8 UTSW 11 67,183,453 (GRCm39) splice site probably null
R7098:Myh8 UTSW 11 67,169,879 (GRCm39) missense probably benign 0.03
R7498:Myh8 UTSW 11 67,174,263 (GRCm39) missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67,189,478 (GRCm39) missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67,194,481 (GRCm39) missense probably benign 0.44
R7825:Myh8 UTSW 11 67,194,538 (GRCm39) missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67,174,644 (GRCm39) missense probably damaging 0.97
R7926:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
R8003:Myh8 UTSW 11 67,190,586 (GRCm39) missense probably damaging 1.00
R8028:Myh8 UTSW 11 67,194,502 (GRCm39) missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67,180,647 (GRCm39) missense probably benign 0.00
R8125:Myh8 UTSW 11 67,190,598 (GRCm39) missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67,179,092 (GRCm39) missense probably benign 0.30
R8277:Myh8 UTSW 11 67,183,735 (GRCm39) missense probably benign 0.10
R8304:Myh8 UTSW 11 67,195,162 (GRCm39) missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67,174,440 (GRCm39) missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67,169,741 (GRCm39) missense probably damaging 1.00
R8795:Myh8 UTSW 11 67,174,203 (GRCm39) critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67,192,820 (GRCm39) missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R8928:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R9031:Myh8 UTSW 11 67,190,141 (GRCm39) missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67,183,260 (GRCm39) missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67,177,302 (GRCm39) missense probably damaging 1.00
R9365:Myh8 UTSW 11 67,174,632 (GRCm39) missense probably benign 0.42
R9468:Myh8 UTSW 11 67,197,730 (GRCm39) missense probably damaging 1.00
R9564:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
R9565:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
T0722:Myh8 UTSW 11 67,195,262 (GRCm39) missense probably benign 0.41
Z1088:Myh8 UTSW 11 67,189,418 (GRCm39) missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67,194,500 (GRCm39) missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67,199,181 (GRCm39) missense possibly damaging 0.64
Z1177:Myh8 UTSW 11 67,192,250 (GRCm39) missense probably damaging 0.99
Z1187:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1188:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1190:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1191:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACGAAGACTCCCGGTAAG -3'
(R):5'- CCCTCTGGAATAGCACTTGC -3'

Sequencing Primer
(F):5'- GACTCCCGGTAAGACACAAAG -3'
(R):5'- CAGTTAAACACATAAGGGATGCTC -3'
Posted On 2018-05-24