Incidental Mutation 'R6452:Qrich2'
ID519429
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116455888 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1370 (T1370I)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208602
AA Change: T1370I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7916:Qrich2 UTSW 11 116455765 missense probably benign 0.04
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAACCATCCCAGGCTGTATCC -3'
(R):5'- AGCCTATCACGGATCAGAGAG -3'

Sequencing Primer
(F):5'- CAGGCTGTATCCTGTCCAGC -3'
(R):5'- TGAAACTCTTCAGCCTAGGCAGG -3'
Posted On2018-05-24