Incidental Mutation 'R6452:Samm50'
ID519439
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene NameSAMM50 sorting and assembly machinery component
Synonyms1110030L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location84192241-84217267 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to G at 84204097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
Predicted Effect probably benign
Transcript: ENSMUST00000023071
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230830
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R1780:Samm50 UTSW 15 84211127 missense probably damaging 0.99
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4285:Samm50 UTSW 15 84197012 missense probably damaging 1.00
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCACTCTTCAGATGCTGAGC -3'
(R):5'- CAGAGGACGATGGAATTCTGTG -3'

Sequencing Primer
(F):5'- TCTTCAGATGCTGAGCAGGCC -3'
(R):5'- ACGATGGAATTCTGTGGTACC -3'
Posted On2018-05-24