Incidental Mutation 'R6452:Olfr1564'
ID519443
Institutional Source Beutler Lab
Gene Symbol Olfr1564
Ensembl Gene ENSMUSG00000096169
Gene Nameolfactory receptor 1564
SynonymsGm4461
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33211206-33221690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33215945 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 133 (N133S)
Ref Sequence ENSEMBL: ENSMUSP00000150573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112162] [ENSMUST00000208645] [ENSMUST00000213642] [ENSMUST00000213751] [ENSMUST00000215450]
Predicted Effect probably benign
Transcript: ENSMUST00000112162
AA Change: N136S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127247
Gene: ENSMUSG00000096169
AA Change: N136S

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 263 1.5e-5 PFAM
Pfam:7tm_1 44 297 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208645
AA Change: N133S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213642
AA Change: N133S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213751
AA Change: N133S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215450
AA Change: N133S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Olfr1564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1564 APN 17 33215973 missense probably benign 0.41
R0079:Olfr1564 UTSW 17 33216105 missense probably benign 0.14
R0939:Olfr1564 UTSW 17 33215661 missense possibly damaging 0.72
R1279:Olfr1564 UTSW 17 33216326 missense possibly damaging 0.59
R2167:Olfr1564 UTSW 17 33215568 missense probably damaging 0.97
R2866:Olfr1564 UTSW 17 33216278 missense probably benign 0.22
R4738:Olfr1564 UTSW 17 33215810 missense probably benign 0.03
R4976:Olfr1564 UTSW 17 33215754 missense probably benign 0.35
R6721:Olfr1564 UTSW 17 33215534 missense probably benign
R7322:Olfr1564 UTSW 17 33215699 missense probably damaging 1.00
R8032:Olfr1564 UTSW 17 33215950 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGTGGAGAAAGCCTTGTGC -3'
(R):5'- CATCATCCCACGCATGTTGG -3'

Sequencing Primer
(F):5'- GACCCTCAGCTGATGGTATCTTCAAG -3'
(R):5'- ACGCATGTTGGCTGACCTG -3'
Posted On2018-05-24