Incidental Mutation 'R6454:Ddx58'
ID519459
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6454 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40220456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 476 (I476F)
Ref Sequence ENSEMBL: ENSMUSP00000042433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
PDB Structure
Mouse RIG-I ATPase Domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000037907
AA Change: I476F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: I476F

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139583
Predicted Effect probably damaging
Transcript: ENSMUST00000142055
AA Change: I431F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296
AA Change: I431F

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myh13 T A 11: 67,350,365 M856K probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Olfr149 A G 9: 39,701,834 *312Q probably null Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ttc38 T A 15: 85,838,822 M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Usp35 A T 7: 97,311,560 N886K probably damaging Het
Usp35 A T 7: 97,311,644 Y858* probably null Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7729:Ddx58 UTSW 4 40206034 missense possibly damaging 0.53
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTCAGTCCACCTCTGAGTATAATC -3'
(R):5'- AATCAGAAGCAGTTCCGAGGTC -3'

Sequencing Primer
(F):5'- AGTCCACCTCTGAGTATAATCTCACC -3'
(R):5'- AGTTCCGAGGTCAGAGGCTTC -3'
Posted On2018-05-24