Mutagenetix > Incidental Mutations

Incidental Mutation 'R6454:Otog'

519477

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.722) question?

Stock #

R6454 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46305817 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 544 (N544D)

Ref Sequence

ENSEMBL: ENSMUSP00000147899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164538] [ENSMUST00000209802]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164538
AA Change: N2729D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: N2729D

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000209802
AA Change: N544D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.1%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,165,628	H145P	possibly damaging	Het
Arid2	C	T	15: 96,372,413	T1469I	probably benign	Het
Atp12a	A	G	14: 56,370,833	T93A	probably benign	Het
Atp8a2	A	T	14: 60,008,499		probably null	Het
Casz1	A	T	4: 148,951,495	I1405F	probably damaging	Het
Chrnb3	T	C	8: 27,393,375	S100P	probably damaging	Het
Creld2	T	A	15: 88,823,071	C197*	probably null	Het
Csmd1	A	T	8: 15,921,150	F3055Y	probably damaging	Het
Ddx58	T	A	4: 40,220,456	I476F	probably damaging	Het
Dnah11	T	A	12: 117,916,855	E3843D	probably benign	Het
Dnah14	T	C	1: 181,783,705	S3799P	probably damaging	Het
Dpp9	A	T	17: 56,206,808	L102Q	probably damaging	Het
Eipr1	T	G	12: 28,864,762	I305S	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Faf1	G	T	4: 109,842,334	A359S	probably benign	Het
Fam13b	A	G	18: 34,457,662		probably null	Het
Fam46b	A	G	4: 133,480,409	D37G	probably damaging	Het
Gm14496	A	T	2: 181,996,222	N363I	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm5346	G	T	8: 43,626,808	N126K	probably damaging	Het
Grm8	T	G	6: 27,363,776	H580P	possibly damaging	Het
Itih5	T	C	2: 10,240,668	F523L	probably benign	Het
Klhl1	A	T	14: 96,280,091	M383K	possibly damaging	Het
Lgi4	A	T	7: 31,060,132	T38S	probably benign	Het
Myh13	T	A	11: 67,350,365	M856K	probably benign	Het
Myo7a	C	T	7: 98,073,167	V1184M	probably benign	Het
Nlrp9c	G	A	7: 26,385,774	R127C	possibly damaging	Het
Notch2	T	C	3: 98,137,406	I1548T	possibly damaging	Het
Nphs2	T	A	1: 156,318,767	H179Q	probably damaging	Het
Nup153	T	C	13: 46,709,660		probably null	Het
Odf2l	C	A	3: 145,153,420	Q517K	possibly damaging	Het
Olfr1013	A	G	2: 85,770,373	K191E	probably benign	Het
Olfr1254	T	C	2: 89,789,178	Y58C	probably damaging	Het
Olfr1448	T	A	19: 12,920,031	N93Y	probably benign	Het
Olfr149	A	G	9: 39,701,834	*312Q	probably null	Het
Omd	A	T	13: 49,589,869	I132F	probably damaging	Het
Ovol3	A	G	7: 30,235,375	Y29H	probably damaging	Het
Papolb	T	C	5: 142,529,598	K97E	possibly damaging	Het
Pcdhb19	G	T	18: 37,499,269	V706L	probably benign	Het
Plekhm1	G	A	11: 103,377,382	R588C	probably damaging	Het
Pnpla6	G	T	8: 3,537,986	V1062L	probably damaging	Het
Ppp1r9a	T	A	6: 4,905,827	F127L	probably damaging	Het
Rnf5	A	C	17: 34,602,309	C47W	probably damaging	Het
Sbno1	A	T	5: 124,400,847	M517K	probably damaging	Het
Slc44a5	C	T	3: 154,243,159	T188M	probably benign	Het
Smco1	A	G	16: 32,273,223	T40A	possibly damaging	Het
Speer4f2	A	T	5: 17,374,433	I77F	probably damaging	Het
Spem2	A	G	11: 69,817,428	L237P	probably damaging	Het
Spg7	A	G	8: 123,079,423	K291E	possibly damaging	Het
Tiam2	A	T	17: 3,438,663	T749S	probably benign	Het
Tln1	T	C	4: 43,533,866	K2291E	probably damaging	Het
Tm6sf1	A	G	7: 81,876,053	M294V	probably damaging	Het
Tmem35b	T	C	4: 127,129,018	*138R	probably null	Het
Tpst1	A	G	5: 130,102,051	K121E	possibly damaging	Het
Tsc22d2	T	A	3: 58,415,840	V51D	possibly damaging	Het
Tshr	C	A	12: 91,538,549	Q754K	probably benign	Het
Ttc38	T	A	15: 85,838,822	M157K	probably damaging	Het
Ube2g2	T	G	10: 77,634,746		probably benign	Het
Ugt2b37	T	G	5: 87,240,977	D459A	probably damaging	Het
Usp35	A	T	7: 97,311,560	N886K	probably damaging	Het
Usp35	A	T	7: 97,311,644	Y858*	probably null	Het
Wdr33	T	C	18: 31,829,975	V125A	possibly damaging	Het
Xpnpep1	G	A	19: 52,997,879	T506I	possibly damaging	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0836:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1843:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2048:Otog	UTSW	7	46287639	missense	probably damaging	1.00
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5757:Otog	UTSW	7	46241121	critical splice donor site	probably null
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7033:Otog	UTSW	7	46267398	critical splice donor site	probably null
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAGTCTTAACAGGTTGCTG -3'
(R):5'- TAGTGCTCATAACCAAGCCCTAG -3'

Sequencing Primer
(F):5'- TGCCTGCTCCAGAAATGGAATCTC -3'
(R):5'- GCTCATAACCAAGCCCTAGTCTGG -3'

Posted On

2018-05-24