Incidental Mutation 'R6454:Usp35'
ID519480
Institutional Source Beutler Lab
Gene Symbol Usp35
Ensembl Gene ENSMUSG00000035713
Gene Nameubiquitin specific peptidase 35
SynonymsLOC381901, LOC244144
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6454 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97309380-97332020 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 97311644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 858 (Y858*)
Ref Sequence ENSEMBL: ENSMUSP00000137927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000139582] [ENSMUST00000168435]
Predicted Effect probably benign
Transcript: ENSMUST00000004622
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139582
AA Change: Y858*
SMART Domains Protein: ENSMUSP00000137726
Gene: ENSMUSG00000035713
AA Change: Y858*

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 5.2e-50 PFAM
Pfam:UCH_1 441 890 1.5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168435
AA Change: Y858*
SMART Domains Protein: ENSMUSP00000137927
Gene: ENSMUSG00000035713
AA Change: Y858*

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 7.1e-48 PFAM
Pfam:UCH_1 441 890 7.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181651
SMART Domains Protein: ENSMUSP00000137720
Gene: ENSMUSG00000035713

DomainStartEndE-ValueType
Pfam:UCH 8 223 1e-24 PFAM
Pfam:UCH_1 9 196 5.7e-22 PFAM
low complexity region 236 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 I476F probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myh13 T A 11: 67,350,365 M856K probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Olfr149 A G 9: 39,701,834 *312Q probably null Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ttc38 T A 15: 85,838,822 M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Usp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03239:Usp35 APN 7 97321592 missense possibly damaging 0.62
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0739:Usp35 UTSW 7 97311667 nonsense probably null
R2655:Usp35 UTSW 7 97312147 missense probably benign
R3623:Usp35 UTSW 7 97312620 missense probably damaging 1.00
R4750:Usp35 UTSW 7 97310339 missense possibly damaging 0.85
R4967:Usp35 UTSW 7 97313575 missense probably damaging 1.00
R5317:Usp35 UTSW 7 97311639 missense probably damaging 0.99
R5341:Usp35 UTSW 7 97325927 missense probably damaging 1.00
R5761:Usp35 UTSW 7 97312351 missense probably benign 0.00
R5894:Usp35 UTSW 7 97313077 missense probably damaging 1.00
R6113:Usp35 UTSW 7 97324326 missense probably damaging 1.00
R6282:Usp35 UTSW 7 97325948 missense probably damaging 1.00
R6454:Usp35 UTSW 7 97311560 missense probably damaging 0.98
R7142:Usp35 UTSW 7 97311547 missense probably damaging 0.97
R7158:Usp35 UTSW 7 97325964 start codon destroyed probably null 0.89
R7260:Usp35 UTSW 7 97320079 missense probably damaging 0.98
RF003:Usp35 UTSW 7 97322096 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAGCACATAGGCAGTGTCC -3'
(R):5'- CTACTACTGTGAGTCCTGTGCC -3'

Sequencing Primer
(F):5'- CACATAGGCAGTGTCCTTAGG -3'
(R):5'- AGGGTCCACGCTACCTCATC -3'
Posted On2018-05-24