Incidental Mutation 'R6454:Gm5346'
ID 519485
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Name predicted gene 5346
Synonyms
MMRRC Submission 044590-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6454 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 43624951-43627276 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43626808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 126 (N126K)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
AlphaFold Q7M766
Predicted Effect probably damaging
Transcript: ENSMUST00000056023
AA Change: N126K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: N126K

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 (GRCm38) H145P possibly damaging Het
Arid2 C T 15: 96,372,413 (GRCm38) T1469I probably benign Het
Atp12a A G 14: 56,370,833 (GRCm38) T93A probably benign Het
Atp8a2 A T 14: 60,008,499 (GRCm38) probably null Het
Casz1 A T 4: 148,951,495 (GRCm38) I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 (GRCm38) S100P probably damaging Het
Creld2 T A 15: 88,823,071 (GRCm38) C197* probably null Het
Csmd1 A T 8: 15,921,150 (GRCm38) F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 (GRCm38) I476F probably damaging Het
Dnah11 T A 12: 117,916,855 (GRCm38) E3843D probably benign Het
Dnah14 T C 1: 181,783,705 (GRCm38) S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 (GRCm38) L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 (GRCm38) I305S probably damaging Het
Enpp5 G A 17: 44,085,264 (GRCm38) G356S probably damaging Het
Faf1 G T 4: 109,842,334 (GRCm38) A359S probably benign Het
Fam13b A G 18: 34,457,662 (GRCm38) probably null Het
Fam46b A G 4: 133,480,409 (GRCm38) D37G probably damaging Het
Gm14496 A T 2: 181,996,222 (GRCm38) N363I probably damaging Het
Gm15922 C G 7: 3,737,320 (GRCm38) A301P probably damaging Het
Grm8 T G 6: 27,363,776 (GRCm38) H580P possibly damaging Het
Itih5 T C 2: 10,240,668 (GRCm38) F523L probably benign Het
Klhl1 A T 14: 96,280,091 (GRCm38) M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 (GRCm38) T38S probably benign Het
Myh13 T A 11: 67,350,365 (GRCm38) M856K probably benign Het
Myo7a C T 7: 98,073,167 (GRCm38) V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 (GRCm38) R127C possibly damaging Het
Notch2 T C 3: 98,137,406 (GRCm38) I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 (GRCm38) H179Q probably damaging Het
Nup153 T C 13: 46,709,660 (GRCm38) probably null Het
Odf2l C A 3: 145,153,420 (GRCm38) Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 (GRCm38) K191E probably benign Het
Olfr1254 T C 2: 89,789,178 (GRCm38) Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 (GRCm38) N93Y probably benign Het
Olfr149 A G 9: 39,701,834 (GRCm38) *312Q probably null Het
Omd A T 13: 49,589,869 (GRCm38) I132F probably damaging Het
Otog A G 7: 46,305,817 (GRCm38) N544D probably damaging Het
Ovol3 A G 7: 30,235,375 (GRCm38) Y29H probably damaging Het
Papolb T C 5: 142,529,598 (GRCm38) K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 (GRCm38) V706L probably benign Het
Plekhm1 G A 11: 103,377,382 (GRCm38) R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 (GRCm38) V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 (GRCm38) F127L probably damaging Het
Rnf5 A C 17: 34,602,309 (GRCm38) C47W probably damaging Het
Sbno1 A T 5: 124,400,847 (GRCm38) M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 (GRCm38) T188M probably benign Het
Smco1 A G 16: 32,273,223 (GRCm38) T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 (GRCm38) I77F probably damaging Het
Spem2 A G 11: 69,817,428 (GRCm38) L237P probably damaging Het
Spg7 A G 8: 123,079,423 (GRCm38) K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 (GRCm38) T749S probably benign Het
Tln1 T C 4: 43,533,866 (GRCm38) K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 (GRCm38) M294V probably damaging Het
Tmem35b T C 4: 127,129,018 (GRCm38) *138R probably null Het
Tpst1 A G 5: 130,102,051 (GRCm38) K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 (GRCm38) V51D possibly damaging Het
Tshr C A 12: 91,538,549 (GRCm38) Q754K probably benign Het
Ttc38 T A 15: 85,838,822 (GRCm38) M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 (GRCm38) probably benign Het
Ugt2b37 T G 5: 87,240,977 (GRCm38) D459A probably damaging Het
Usp35 A T 7: 97,311,644 (GRCm38) Y858* probably null Het
Usp35 A T 7: 97,311,560 (GRCm38) N886K probably damaging Het
Wdr33 T C 18: 31,829,975 (GRCm38) V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 (GRCm38) T506I possibly damaging Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43,625,381 (GRCm38) missense probably benign 0.12
IGL00391:Gm5346 APN 8 43,625,629 (GRCm38) missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43,626,351 (GRCm38) missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43,625,969 (GRCm38) missense probably benign
IGL01095:Gm5346 APN 8 43,626,096 (GRCm38) missense probably benign 0.22
IGL01113:Gm5346 APN 8 43,626,152 (GRCm38) missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43,626,433 (GRCm38) missense probably benign 0.06
IGL01782:Gm5346 APN 8 43,626,735 (GRCm38) missense probably benign 0.01
IGL01921:Gm5346 APN 8 43,625,511 (GRCm38) missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43,626,761 (GRCm38) missense probably benign 0.00
IGL02139:Gm5346 APN 8 43,625,578 (GRCm38) missense probably benign 0.01
IGL02555:Gm5346 APN 8 43,625,268 (GRCm38) missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43,627,088 (GRCm38) missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43,625,503 (GRCm38) nonsense probably null
R0218:Gm5346 UTSW 8 43,626,440 (GRCm38) missense probably benign 0.00
R0530:Gm5346 UTSW 8 43,626,531 (GRCm38) missense probably benign 0.00
R0925:Gm5346 UTSW 8 43,626,303 (GRCm38) missense probably benign 0.11
R0927:Gm5346 UTSW 8 43,625,123 (GRCm38) missense probably benign 0.00
R0975:Gm5346 UTSW 8 43,625,118 (GRCm38) missense probably benign
R1300:Gm5346 UTSW 8 43,626,844 (GRCm38) nonsense probably null
R1728:Gm5346 UTSW 8 43,625,583 (GRCm38) missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43,625,583 (GRCm38) missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43,625,917 (GRCm38) nonsense probably null
R1869:Gm5346 UTSW 8 43,625,095 (GRCm38) nonsense probably null
R1870:Gm5346 UTSW 8 43,625,095 (GRCm38) nonsense probably null
R1871:Gm5346 UTSW 8 43,625,095 (GRCm38) nonsense probably null
R1992:Gm5346 UTSW 8 43,627,139 (GRCm38) missense probably benign 0.44
R2008:Gm5346 UTSW 8 43,627,037 (GRCm38) missense probably benign 0.00
R2013:Gm5346 UTSW 8 43,626,405 (GRCm38) missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43,625,917 (GRCm38) nonsense probably null
R2175:Gm5346 UTSW 8 43,625,438 (GRCm38) missense probably benign
R2875:Gm5346 UTSW 8 43,627,140 (GRCm38) nonsense probably null
R3406:Gm5346 UTSW 8 43,626,052 (GRCm38) nonsense probably null
R3845:Gm5346 UTSW 8 43,626,632 (GRCm38) missense probably benign 0.00
R4033:Gm5346 UTSW 8 43,626,673 (GRCm38) missense probably benign 0.28
R4072:Gm5346 UTSW 8 43,626,350 (GRCm38) missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43,626,350 (GRCm38) missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43,626,350 (GRCm38) missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43,626,350 (GRCm38) missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43,626,527 (GRCm38) missense probably benign 0.04
R4330:Gm5346 UTSW 8 43,626,250 (GRCm38) missense probably benign
R4612:Gm5346 UTSW 8 43,626,550 (GRCm38) missense probably benign 0.09
R4662:Gm5346 UTSW 8 43,627,079 (GRCm38) missense probably benign 0.26
R5032:Gm5346 UTSW 8 43,626,471 (GRCm38) missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43,627,163 (GRCm38) missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43,625,282 (GRCm38) missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43,626,579 (GRCm38) missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43,625,912 (GRCm38) missense probably benign 0.00
R6233:Gm5346 UTSW 8 43,625,912 (GRCm38) missense probably benign 0.00
R6234:Gm5346 UTSW 8 43,625,912 (GRCm38) missense probably benign 0.00
R6235:Gm5346 UTSW 8 43,625,912 (GRCm38) missense probably benign 0.00
R6241:Gm5346 UTSW 8 43,626,096 (GRCm38) missense probably benign 0.22
R6392:Gm5346 UTSW 8 43,626,001 (GRCm38) missense probably benign 0.09
R6439:Gm5346 UTSW 8 43,625,951 (GRCm38) missense probably damaging 1.00
R6455:Gm5346 UTSW 8 43,626,152 (GRCm38) missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43,626,914 (GRCm38) missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43,625,183 (GRCm38) missense probably benign 0.00
R6877:Gm5346 UTSW 8 43,625,237 (GRCm38) missense probably benign 0.02
R6911:Gm5346 UTSW 8 43,625,109 (GRCm38) missense probably benign 0.02
R7211:Gm5346 UTSW 8 43,625,877 (GRCm38) missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43,625,244 (GRCm38) missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43,626,666 (GRCm38) missense probably damaging 0.99
R7797:Gm5346 UTSW 8 43,626,374 (GRCm38) missense probably benign 0.04
R7981:Gm5346 UTSW 8 43,625,813 (GRCm38) missense probably damaging 1.00
R8154:Gm5346 UTSW 8 43,625,387 (GRCm38) missense probably damaging 0.97
R8215:Gm5346 UTSW 8 43,626,501 (GRCm38) missense probably benign 0.05
R9180:Gm5346 UTSW 8 43,626,933 (GRCm38) nonsense probably null
R9307:Gm5346 UTSW 8 43,626,267 (GRCm38) missense probably benign 0.00
R9733:Gm5346 UTSW 8 43,626,149 (GRCm38) missense possibly damaging 0.94
RF001:Gm5346 UTSW 8 43,626,905 (GRCm38) missense possibly damaging 0.79
Z1177:Gm5346 UTSW 8 43,626,546 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGAGTGGAGGCATTGCTTTC -3'
(R):5'- TCCTATAGCCTGAGCATTGGG -3'

Sequencing Primer
(F):5'- AGGCATTGCTTTCCTGAAGG -3'
(R):5'- ACCAAGGTGATCTCCTTG -3'
Posted On 2018-05-24