Incidental Mutation 'R6454:Olfr149'
ID519487
Institutional Source Beutler Lab
Gene Symbol Olfr149
Ensembl Gene ENSMUSG00000062121
Gene Nameolfactory receptor 149
SynonymsGA_x6K02T2PVTD-33400306-33399371, MOR224-8, M31
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6454 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39700518-39707117 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 39701834 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 312 (*312Q)
Ref Sequence ENSEMBL: ENSMUSP00000149664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082027] [ENSMUST00000215192]
Predicted Effect probably null
Transcript: ENSMUST00000082027
AA Change: *312Q
SMART Domains Protein: ENSMUSP00000080686
Gene: ENSMUSG00000062121
AA Change: *312Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 223 3.8e-9 PFAM
Pfam:7tm_1 39 286 1.2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215192
AA Change: *312Q
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 I476F probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myh13 T A 11: 67,350,365 M856K probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ttc38 T A 15: 85,838,822 M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Usp35 A T 7: 97,311,560 N886K probably damaging Het
Usp35 A T 7: 97,311,644 Y858* probably null Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Olfr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr149 APN 9 39702253 missense probably damaging 1.00
IGL02707:Olfr149 APN 9 39702641 missense probably damaging 0.99
IGL02730:Olfr149 APN 9 39702238 missense probably damaging 1.00
IGL03375:Olfr149 APN 9 39702575 missense probably damaging 1.00
R0244:Olfr149 UTSW 9 39702173 missense probably damaging 0.97
R0358:Olfr149 UTSW 9 39702001 missense possibly damaging 0.95
R4179:Olfr149 UTSW 9 39702091 missense probably benign 0.30
R5120:Olfr149 UTSW 9 39702070 missense probably benign 0.00
R5185:Olfr149 UTSW 9 39701876 missense probably benign
R5818:Olfr149 UTSW 9 39702365 missense probably benign 0.01
R6029:Olfr149 UTSW 9 39702400 missense probably damaging 1.00
R6207:Olfr149 UTSW 9 39702310 missense probably benign 0.06
R7451:Olfr149 UTSW 9 39702127 missense probably damaging 0.99
R8193:Olfr149 UTSW 9 39702202 missense possibly damaging 0.90
R8263:Olfr149 UTSW 9 39702157 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCTCTCTAGATGTCAAATCTTTGC -3'
(R):5'- ACCTGCAGTGCCCATTTTAC -3'

Sequencing Primer
(F):5'- TAATCTGCGCATGTGCCAAG -3'
(R):5'- GCCAGTGATTTTCATTTATCTAAGGC -3'
Posted On2018-05-24