Incidental Mutation 'R6454:Myh13'
ID519489
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6454 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67350365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 856 (M856K)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: M856K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: M856K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: M856K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: M856K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: M856K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: M856K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 I476F probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Olfr149 A G 9: 39,701,834 *312Q probably null Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ttc38 T A 15: 85,838,822 M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Usp35 A T 7: 97,311,560 N886K probably damaging Het
Usp35 A T 7: 97,311,644 Y858* probably null Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGATGAAGATTCTGAGACCTGTC -3'
(R):5'- TCCTGGGAATCTGTACTTTGC -3'

Sequencing Primer
(F):5'- ATTCTGAGACCTGTCGGGGAG -3'
(R):5'- CTTTGCACTCTCGGGTAGAAGAAAC -3'
Posted On2018-05-24