Incidental Mutation 'R6454:Ttc38'
ID519500
Institutional Source Beutler Lab
Gene Symbol Ttc38
Ensembl Gene ENSMUSG00000035944
Gene Nametetratricopeptide repeat domain 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6454 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85832306-85858822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85838822 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 157 (M157K)
Ref Sequence ENSEMBL: ENSMUSP00000114504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124011] [ENSMUST00000146088]
Predicted Effect probably benign
Transcript: ENSMUST00000124011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133158
Predicted Effect probably damaging
Transcript: ENSMUST00000146088
AA Change: M157K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944
AA Change: M157K

DomainStartEndE-ValueType
SCOP:d1ld8a_ 105 272 1e-7 SMART
low complexity region 342 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 I476F probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myh13 T A 11: 67,350,365 M856K probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Olfr149 A G 9: 39,701,834 *312Q probably null Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Usp35 A T 7: 97,311,560 N886K probably damaging Het
Usp35 A T 7: 97,311,644 Y858* probably null Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Ttc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc38 APN 15 85844462 missense possibly damaging 0.76
IGL01596:Ttc38 APN 15 85836073 missense possibly damaging 0.89
IGL03221:Ttc38 APN 15 85834541 missense probably benign 0.00
hairy UTSW 15 85851601 splice site probably null
Stubble UTSW 15 85844515 nonsense probably null
PIT4431001:Ttc38 UTSW 15 85836127 missense probably benign
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0081:Ttc38 UTSW 15 85856472 missense probably benign 0.04
R0143:Ttc38 UTSW 15 85853719 missense possibly damaging 0.51
R0764:Ttc38 UTSW 15 85846403 splice site probably benign
R1745:Ttc38 UTSW 15 85833172 missense probably damaging 1.00
R1837:Ttc38 UTSW 15 85851563 missense probably damaging 1.00
R2069:Ttc38 UTSW 15 85838788 missense probably damaging 1.00
R2086:Ttc38 UTSW 15 85838727 missense probably benign
R2151:Ttc38 UTSW 15 85851601 splice site probably null
R2228:Ttc38 UTSW 15 85844503 missense probably benign 0.01
R4641:Ttc38 UTSW 15 85844458 missense possibly damaging 0.87
R4705:Ttc38 UTSW 15 85852963 missense probably benign 0.00
R4721:Ttc38 UTSW 15 85838746 missense probably benign
R5037:Ttc38 UTSW 15 85844540 missense probably benign 0.16
R6208:Ttc38 UTSW 15 85841497 missense possibly damaging 0.56
R7326:Ttc38 UTSW 15 85852861 missense probably benign 0.00
R7809:Ttc38 UTSW 15 85838738 missense possibly damaging 0.65
R8195:Ttc38 UTSW 15 85844515 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAAGCAGTTCAGGCAGATGG -3'
(R):5'- TTCACAGGATGGGACGAAGC -3'

Sequencing Primer
(F):5'- CAGATGGTGGCGCAGGATG -3'
(R):5'- AGCCTTTTAGATTAGCAGCAGG -3'
Posted On2018-05-24