Incidental Mutation 'R6454:Enpp5'
ID 519506
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms D17Abb1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6454 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 44078813-44086567 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44085264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
AlphaFold Q9EQG7
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,628 H145P possibly damaging Het
Arid2 C T 15: 96,372,413 T1469I probably benign Het
Atp12a A G 14: 56,370,833 T93A probably benign Het
Atp8a2 A T 14: 60,008,499 probably null Het
Casz1 A T 4: 148,951,495 I1405F probably damaging Het
Chrnb3 T C 8: 27,393,375 S100P probably damaging Het
Creld2 T A 15: 88,823,071 C197* probably null Het
Csmd1 A T 8: 15,921,150 F3055Y probably damaging Het
Ddx58 T A 4: 40,220,456 I476F probably damaging Het
Dnah11 T A 12: 117,916,855 E3843D probably benign Het
Dnah14 T C 1: 181,783,705 S3799P probably damaging Het
Dpp9 A T 17: 56,206,808 L102Q probably damaging Het
Eipr1 T G 12: 28,864,762 I305S probably damaging Het
Faf1 G T 4: 109,842,334 A359S probably benign Het
Fam13b A G 18: 34,457,662 probably null Het
Fam46b A G 4: 133,480,409 D37G probably damaging Het
Gm14496 A T 2: 181,996,222 N363I probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm5346 G T 8: 43,626,808 N126K probably damaging Het
Grm8 T G 6: 27,363,776 H580P possibly damaging Het
Itih5 T C 2: 10,240,668 F523L probably benign Het
Klhl1 A T 14: 96,280,091 M383K possibly damaging Het
Lgi4 A T 7: 31,060,132 T38S probably benign Het
Myh13 T A 11: 67,350,365 M856K probably benign Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nlrp9c G A 7: 26,385,774 R127C possibly damaging Het
Notch2 T C 3: 98,137,406 I1548T possibly damaging Het
Nphs2 T A 1: 156,318,767 H179Q probably damaging Het
Nup153 T C 13: 46,709,660 probably null Het
Odf2l C A 3: 145,153,420 Q517K possibly damaging Het
Olfr1013 A G 2: 85,770,373 K191E probably benign Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr1448 T A 19: 12,920,031 N93Y probably benign Het
Olfr149 A G 9: 39,701,834 *312Q probably null Het
Omd A T 13: 49,589,869 I132F probably damaging Het
Otog A G 7: 46,305,817 N544D probably damaging Het
Ovol3 A G 7: 30,235,375 Y29H probably damaging Het
Papolb T C 5: 142,529,598 K97E possibly damaging Het
Pcdhb19 G T 18: 37,499,269 V706L probably benign Het
Plekhm1 G A 11: 103,377,382 R588C probably damaging Het
Pnpla6 G T 8: 3,537,986 V1062L probably damaging Het
Ppp1r9a T A 6: 4,905,827 F127L probably damaging Het
Rnf5 A C 17: 34,602,309 C47W probably damaging Het
Sbno1 A T 5: 124,400,847 M517K probably damaging Het
Slc44a5 C T 3: 154,243,159 T188M probably benign Het
Smco1 A G 16: 32,273,223 T40A possibly damaging Het
Speer4f2 A T 5: 17,374,433 I77F probably damaging Het
Spem2 A G 11: 69,817,428 L237P probably damaging Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Tiam2 A T 17: 3,438,663 T749S probably benign Het
Tln1 T C 4: 43,533,866 K2291E probably damaging Het
Tm6sf1 A G 7: 81,876,053 M294V probably damaging Het
Tmem35b T C 4: 127,129,018 *138R probably null Het
Tpst1 A G 5: 130,102,051 K121E possibly damaging Het
Tsc22d2 T A 3: 58,415,840 V51D possibly damaging Het
Tshr C A 12: 91,538,549 Q754K probably benign Het
Ttc38 T A 15: 85,838,822 M157K probably damaging Het
Ube2g2 T G 10: 77,634,746 probably benign Het
Ugt2b37 T G 5: 87,240,977 D459A probably damaging Het
Usp35 A T 7: 97,311,560 N886K probably damaging Het
Usp35 A T 7: 97,311,644 Y858* probably null Het
Wdr33 T C 18: 31,829,975 V125A possibly damaging Het
Xpnpep1 G A 19: 52,997,879 T506I possibly damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44081511 critical splice donor site probably null
R9256:Enpp5 UTSW 17 44085523 missense probably benign 0.00
R9321:Enpp5 UTSW 17 44082798 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'
Posted On 2018-05-24