Mutagenetix > Incidental Mutation

Incidental Mutation 'R6455:Adcy10'

519517

Institutional Source

Beutler Lab

Gene Symbol

Adcy10

Ensembl Gene

ENSMUSG00000026567

Gene Name

adenylate cyclase 10

Synonyms

sAC, Sacy, soluble adenylyl cyclase

MMRRC Submission

044591-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.376) question?

Stock #

R6455 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

165485183-165576774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 165518374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Glutamic Acid at position 331 (Q331E)

Ref Sequence

ENSEMBL: ENSMUSP00000137959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]

AlphaFold

Q8C0T9

Predicted Effect

probably damaging
Transcript: ENSMUST00000027852
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: Q331E

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	442	2.3e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111439
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: Q331E

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111440
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: Q331E

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000148550
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: Q331E

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	420	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155216

SMART Domains

Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
PDB:4OZ3\|A	1	98	2e-51	PDB
Blast:CYCc	7	98	2e-61	BLAST
SCOP:d1azsb_	43	98	9e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195194

Meta Mutation Damage Score

0.0926

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	T	A	9: 35,844,055	K3*	probably null	Het
A430078G23Rik	A	T	8: 3,388,753	Y370F	probably benign	Het
Abca1	T	C	4: 53,042,376	R1899G	probably damaging	Het
Abca6	C	T	11: 110,241,581	G296D	probably damaging	Het
Abcb5	A	T	12: 118,890,549		probably null	Het
Adam28	T	G	14: 68,633,208	T339P	probably damaging	Het
Aldh1a2	A	T	9: 71,252,914		probably null	Het
Alms1	T	A	6: 85,696,657	I3078N	probably damaging	Het
Amtn	A	T	5: 88,380,280	N71Y	probably damaging	Het
Arid4a	T	C	12: 71,075,088	S748P	probably benign	Het
Atp2b1	C	A	10: 99,016,980	Q108K	possibly damaging	Het
Bcdin3d	T	C	15: 99,470,949	D123G	probably benign	Het
Capn15	A	G	17: 25,965,436	S24P	probably damaging	Het
Cc2d2a	T	A	5: 43,739,412	S1550R	possibly damaging	Het
Ccdc7a	C	T	8: 128,832,610	V1174M	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Ceacam3	T	C	7: 17,161,938	I611T	possibly damaging	Het
Chrna1	C	T	2: 73,566,836	D370N	possibly damaging	Het
Diexf	G	T	1: 193,128,376	D106E	probably benign	Het
Dlg2	C	A	7: 92,444,508		probably null	Het
Dll4	A	T	2: 119,333,795		probably null	Het
Eif5b	T	C	1: 38,019,027	S137P	probably benign	Het
Epn2	A	T	11: 61,533,641	M250K	probably damaging	Het
Fat2	T	A	11: 55,270,457	Q3149L	probably damaging	Het
Fbxl13	G	A	5: 21,556,814	S341F	probably benign	Het
Gm15922	T	A	7: 3,738,931	Y150F	probably benign	Het
Gm5141	A	T	13: 62,774,783	C191S	probably damaging	Het
Gm5150	C	T	3: 15,990,651	G137S	probably damaging	Het
Gm5346	T	A	8: 43,626,152	H345L	probably damaging	Het
Gpr75	C	T	11: 30,891,529	R145W	probably damaging	Het
Heatr5b	G	A	17: 78,753,073	H2058Y	probably benign	Het
Ina	G	A	19: 47,023,561	E473K	probably benign	Het
Irx6	T	C	8: 92,676,072	S22P	probably benign	Het
Itpr1	T	A	6: 108,417,972	M32K	probably damaging	Het
Jmjd1c	T	A	10: 67,226,016	S1383T	probably benign	Het
Lclat1	T	A	17: 73,161,833	S3T	probably damaging	Het
Llgl1	G	A	11: 60,709,660	V612M	probably damaging	Het
Mios	A	G	6: 8,231,239	R708G	probably benign	Het
Mphosph8	T	C	14: 56,688,486	L636P	probably damaging	Het
Mrgpra2b	T	A	7: 47,464,145	N254Y	probably damaging	Het
Myo7a	C	T	7: 98,073,167	V1184M	probably benign	Het
Myog	G	A	1: 134,290,488	D145N	probably benign	Het
Nat10	T	A	2: 103,739,886	I371F	possibly damaging	Het
Neb	A	T	2: 52,167,644	Y229*	probably null	Het
Nlrp6	T	A	7: 140,927,509	I896K	possibly damaging	Het
Olfr235	T	C	19: 12,268,706	S159P	probably damaging	Het
Olfr551	G	A	7: 102,588,671	A24V	probably benign	Het
Olfr740	A	T	14: 50,453,585	I178L	possibly damaging	Het
Pcdhgc5	A	C	18: 37,821,248	E525A	probably damaging	Het
Pkd2	C	A	5: 104,459,924	D96E	probably benign	Het
Prtg	A	G	9: 72,907,856	D1022G	probably damaging	Het
Ptpn13	T	C	5: 103,541,284	M981T	probably benign	Het
Rc3h2	C	A	2: 37,409,470	A183S	probably damaging	Het
Rorb	A	T	19: 18,960,492	I270N	probably damaging	Het
Rpgrip1	C	T	14: 52,141,189	R524W	probably damaging	Het
Slc25a10	T	C	11: 120,495,205	V124A	probably damaging	Het
Slc40a1	T	A	1: 45,918,947	I109F	probably damaging	Het
Spen	G	A	4: 141,475,509	R1936W	probably damaging	Het
St6gal2	T	A	17: 55,482,513	Y183N	probably benign	Het
Svil	A	G	18: 5,056,629	K588E	possibly damaging	Het
Tas2r122	C	T	6: 132,711,663	W89*	probably null	Het
Tbxas1	T	A	6: 38,952,145		probably benign	Het
Tia1	T	A	6: 86,420,378	I111N	probably damaging	Het
Tlr9	T	A	9: 106,223,999	L163H	probably damaging	Het
Tnn	C	T	1: 160,114,719	V806M	probably damaging	Het
Traf5	G	A	1: 191,999,926	A318V	probably benign	Het
Ttc3	T	A	16: 94,418,623	M1K	probably null	Het
Vmn1r192	T	A	13: 22,187,830	R73S	probably benign	Het
Vmn1r71	T	C	7: 10,748,404	Y53C	probably benign	Het
Vmn2r34	T	A	7: 7,683,583	N372Y	probably damaging	Het
Wbp2	A	T	11: 116,079,753	S229R	probably damaging	Het
Wdr18	C	T	10: 79,965,281	T176I	probably damaging	Het

Other mutations in Adcy10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Adcy10	APN	1	165551914	missense	probably benign	0.45
IGL00731:Adcy10	APN	1	165572614	missense	probably benign
IGL01099:Adcy10	APN	1	165539842	missense	probably benign	0.21
IGL01464:Adcy10	APN	1	165546587	missense	probably damaging	1.00
IGL01729:Adcy10	APN	1	165513168	critical splice donor site	probably null
IGL02002:Adcy10	APN	1	165521843	missense	probably damaging	1.00
IGL02094:Adcy10	APN	1	165570620	missense	probably damaging	1.00
IGL02132:Adcy10	APN	1	165572543	missense	probably damaging	0.96
IGL02276:Adcy10	APN	1	165559128	missense	probably damaging	0.96
IGL02408:Adcy10	APN	1	165538380	missense	probably damaging	1.00
IGL02410:Adcy10	APN	1	165510408	missense	probably damaging	1.00
IGL02445:Adcy10	APN	1	165570744	missense	possibly damaging	0.85
IGL02470:Adcy10	APN	1	165567726	missense	probably damaging	1.00
IGL02551:Adcy10	APN	1	165543233	missense	probably damaging	1.00
IGL02606:Adcy10	APN	1	165519518	missense	possibly damaging	0.88
IGL02609:Adcy10	APN	1	165538475	nonsense	probably null
Bugged	UTSW	1	165564237	missense	probably damaging	0.99
debye	UTSW	1	165551361	critical splice donor site	probably null
malaysian	UTSW	1	165513127	missense	probably benign	0.38
singaporean	UTSW	1	165518312	missense	probably damaging	0.98
PIT4514001:Adcy10	UTSW	1	165556791	missense	probably benign	0.28
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0276:Adcy10	UTSW	1	165572591	missense	possibly damaging	0.88
R0324:Adcy10	UTSW	1	165564249	missense	probably benign	0.00
R0433:Adcy10	UTSW	1	165552022	missense	probably damaging	1.00
R0454:Adcy10	UTSW	1	165570728	missense	probably damaging	1.00
R0501:Adcy10	UTSW	1	165510390	missense	probably damaging	1.00
R0513:Adcy10	UTSW	1	165519519	missense	probably benign	0.04
R0533:Adcy10	UTSW	1	165564023	missense	probably benign	0.05
R0550:Adcy10	UTSW	1	165565315	missense	probably benign	0.00
R0554:Adcy10	UTSW	1	165513130	missense	probably benign
R0597:Adcy10	UTSW	1	165525062	critical splice donor site	probably null
R0629:Adcy10	UTSW	1	165543105	missense	probably damaging	1.00
R1421:Adcy10	UTSW	1	165563947	missense	probably damaging	0.98
R1454:Adcy10	UTSW	1	165515380	missense	possibly damaging	0.66
R1524:Adcy10	UTSW	1	165518403	missense	probably damaging	1.00
R1534:Adcy10	UTSW	1	165518312	missense	probably damaging	0.98
R1594:Adcy10	UTSW	1	165525033	missense	probably benign	0.02
R1690:Adcy10	UTSW	1	165519925	missense	probably damaging	1.00
R1842:Adcy10	UTSW	1	165503243	missense	probably damaging	1.00
R1859:Adcy10	UTSW	1	165521961	missense	probably damaging	1.00
R1885:Adcy10	UTSW	1	165570808	missense	probably benign	0.02
R1929:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2005:Adcy10	UTSW	1	165525022	missense	probably benign	0.02
R2211:Adcy10	UTSW	1	165518212	missense	probably damaging	1.00
R2225:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2227:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2272:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2421:Adcy10	UTSW	1	165558597	missense	probably damaging	0.97
R3614:Adcy10	UTSW	1	165575727	missense	probably benign	0.38
R4538:Adcy10	UTSW	1	165513127	missense	probably benign	0.38
R4644:Adcy10	UTSW	1	165551361	critical splice donor site	probably null
R4649:Adcy10	UTSW	1	165504049	missense	probably damaging	1.00
R4832:Adcy10	UTSW	1	165506644	missense	probably damaging	1.00
R4853:Adcy10	UTSW	1	165548213	missense	probably benign
R4916:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R4951:Adcy10	UTSW	1	165563963	missense	probably damaging	1.00
R4972:Adcy10	UTSW	1	165556862	missense	probably damaging	1.00
R5116:Adcy10	UTSW	1	165519500	missense	probably damaging	1.00
R5377:Adcy10	UTSW	1	165519895	missense	probably damaging	1.00
R5442:Adcy10	UTSW	1	165513140	missense	probably benign	0.43
R5692:Adcy10	UTSW	1	165515306	missense	probably benign	0.36
R5949:Adcy10	UTSW	1	165539817	missense	possibly damaging	0.79
R5998:Adcy10	UTSW	1	165541649	missense	probably benign	0.19
R6238:Adcy10	UTSW	1	165575728	nonsense	probably null
R6920:Adcy10	UTSW	1	165575658	missense	probably damaging	1.00
R6935:Adcy10	UTSW	1	165506635	missense	probably benign	0.21
R6957:Adcy10	UTSW	1	165564285	missense	probably damaging	1.00
R6970:Adcy10	UTSW	1	165556916	missense	probably benign	0.02
R7027:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R7049:Adcy10	UTSW	1	165539874	missense	probably damaging	1.00
R7062:Adcy10	UTSW	1	165538522	missense	probably benign	0.27
R7130:Adcy10	UTSW	1	165504047	missense	probably damaging	1.00
R7144:Adcy10	UTSW	1	165510370	missense	probably benign	0.01
R7182:Adcy10	UTSW	1	165543470	splice site	probably null
R7228:Adcy10	UTSW	1	165510272	missense	probably damaging	1.00
R7384:Adcy10	UTSW	1	165576608	missense	unknown
R7561:Adcy10	UTSW	1	165559172	missense	possibly damaging	0.94
R7603:Adcy10	UTSW	1	165564237	missense	probably damaging	0.99
R7693:Adcy10	UTSW	1	165570771	missense	probably benign	0.01
R7812:Adcy10	UTSW	1	165515369	missense	probably damaging	1.00
R7905:Adcy10	UTSW	1	165513168	critical splice donor site	probably null
R8040:Adcy10	UTSW	1	165552024	missense	probably damaging	1.00
R8242:Adcy10	UTSW	1	165546549	missense	possibly damaging	0.82
R8278:Adcy10	UTSW	1	165503288	missense	probably damaging	1.00
R8282:Adcy10	UTSW	1	165510337	missense	probably benign	0.34
R8812:Adcy10	UTSW	1	165551298	missense	probably damaging	0.98
R9039:Adcy10	UTSW	1	165518345	missense	probably damaging	1.00
R9178:Adcy10	UTSW	1	165575649	missense	possibly damaging	0.79
R9244:Adcy10	UTSW	1	165543110	missense	probably benign	0.00
R9712:Adcy10	UTSW	1	165513112	missense	probably damaging	1.00
RF018:Adcy10	UTSW	1	165552109	missense	probably damaging	1.00
Z1177:Adcy10	UTSW	1	165510276	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCTAGAGTGGTGCTAAAAGGGTTC -3'
(R):5'- GGCCATGCATGAGCTGTTAC -3'

Sequencing Primer
(F):5'- TAAAAGGGTTCTGCTGCCC -3'
(R):5'- AGCTGTTACAAAGAGTGGTGTCCTAC -3'

Posted On

2018-05-24