Incidental Mutation 'R6455:Adcy10'
List |< first << previous [record 63 of 1826] next >> last >|
ID519517
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R6455 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 165518374 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 331 (Q331E)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: Q331E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: Q331E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: Q331E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: Q331E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: Q331E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M80K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N280Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y6387* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I281N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 C110S probably null Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 unclassified probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 unclassified probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 unclassified probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTAGAGTGGTGCTAAAAGGGTTC -3'
(R):5'- GGCCATGCATGAGCTGTTAC -3'

Sequencing Primer
(F):5'- TAAAAGGGTTCTGCTGCCC -3'
(R):5'- AGCTGTTACAAAGAGTGGTGTCCTAC -3'
Posted OnMay 24, 2018