Incidental Mutation 'R6455:Tbxas1'
ID519534
Institutional Source Beutler Lab
Gene Symbol Tbxas1
Ensembl Gene ENSMUSG00000029925
Gene Namethromboxane A synthase 1, platelet
SynonymsTXAS, TXS, CYP5A1, CYP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6455 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38875404-39084585 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 38952145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003017] [ENSMUST00000160963] [ENSMUST00000162521]
Predicted Effect probably benign
Transcript: ENSMUST00000003017
SMART Domains Protein: ENSMUSP00000003017
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Pfam:p450 44 530 1.5e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159226
Predicted Effect probably benign
Transcript: ENSMUST00000160963
SMART Domains Protein: ENSMUSP00000124640
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
Pfam:p450 30 134 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161781
Predicted Effect unknown
Transcript: ENSMUST00000162521
AA Change: C110S
SMART Domains Protein: ENSMUSP00000125406
Gene: ENSMUSG00000029925
AA Change: C110S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
SCOP:d1e9xa_ 43 79 6e-6 SMART
transmembrane domain 95 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201966
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display increased bleeding time and decreased platelet response to arachidonic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Tbxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Tbxas1 APN 6 39021181 missense probably damaging 0.97
IGL01319:Tbxas1 APN 6 39017973 missense probably benign 0.09
IGL01633:Tbxas1 APN 6 38982191 missense probably benign 0.00
IGL01712:Tbxas1 APN 6 39081060 missense probably benign 0.00
IGL01860:Tbxas1 APN 6 38948627 missense probably damaging 1.00
IGL01964:Tbxas1 APN 6 39083814 missense probably benign 0.00
IGL02036:Tbxas1 APN 6 39021157 missense probably benign
IGL02335:Tbxas1 APN 6 39023080 missense probably damaging 1.00
IGL02615:Tbxas1 APN 6 39027866 missense probably damaging 1.00
R0245:Tbxas1 UTSW 6 39027768 missense probably benign 0.00
R1677:Tbxas1 UTSW 6 39017888 splice site probably benign
R1975:Tbxas1 UTSW 6 38948641 splice site probably benign
R1977:Tbxas1 UTSW 6 38948641 splice site probably benign
R2308:Tbxas1 UTSW 6 39027661 missense probably benign 0.08
R4394:Tbxas1 UTSW 6 39027779 missense probably benign 0.19
R4702:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4703:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4705:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4935:Tbxas1 UTSW 6 39023047 missense probably benign 0.02
R5424:Tbxas1 UTSW 6 39027905 missense possibly damaging 0.72
R5704:Tbxas1 UTSW 6 39021133 missense probably benign 0.20
R6358:Tbxas1 UTSW 6 38952112 intron probably benign
R6823:Tbxas1 UTSW 6 38919153 start codon destroyed possibly damaging 0.94
R6868:Tbxas1 UTSW 6 39084306 missense probably damaging 1.00
R6888:Tbxas1 UTSW 6 38952074 intron probably benign
R7500:Tbxas1 UTSW 6 38982212 nonsense probably null
R8026:Tbxas1 UTSW 6 39027896 missense probably benign 0.12
R8351:Tbxas1 UTSW 6 39027916 missense possibly damaging 0.67
R8729:Tbxas1 UTSW 6 39001338 missense probably benign 0.33
R8837:Tbxas1 UTSW 6 39071430 missense
Z1177:Tbxas1 UTSW 6 39021104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGAACTCCGAGAGCGATAC -3'
(R):5'- AGCCTCATCGGAATGCACTG -3'

Sequencing Primer
(F):5'- CCTCTGTGTGGGTAAGAGAAAGACTC -3'
(R):5'- TCAGCACCTGAGAGCATTTG -3'
Posted On2018-05-24