Incidental Mutation 'R6455:Irx6'
ID 519551
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene Name Iroquois homeobox 6
Synonyms
MMRRC Submission 044591-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R6455 (G1)
Quality Score 222.009
Status Validated
Chromosome 8
Chromosomal Location 92674288-92680956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92676072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000034185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
AlphaFold Q9ER75
Predicted Effect probably benign
Transcript: ENSMUST00000034185
AA Change: S22P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: S22P

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167261
AA Change: S22P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: S22P

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210252
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 (GRCm38) K3* probably null Het
A430078G23Rik A T 8: 3,388,753 (GRCm38) Y370F probably benign Het
Abca1 T C 4: 53,042,376 (GRCm38) R1899G probably damaging Het
Abca6 C T 11: 110,241,581 (GRCm38) G296D probably damaging Het
Abcb5 A T 12: 118,890,549 (GRCm38) probably null Het
Adam28 T G 14: 68,633,208 (GRCm38) T339P probably damaging Het
Adcy10 C G 1: 165,518,374 (GRCm38) Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 (GRCm38) probably null Het
Alms1 T A 6: 85,696,657 (GRCm38) I3078N probably damaging Het
Amtn A T 5: 88,380,280 (GRCm38) N71Y probably damaging Het
Arid4a T C 12: 71,075,088 (GRCm38) S748P probably benign Het
Atp2b1 C A 10: 99,016,980 (GRCm38) Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 (GRCm38) D123G probably benign Het
Capn15 A G 17: 25,965,436 (GRCm38) S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 (GRCm38) S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 (GRCm38) V1174M probably damaging Het
Cd22 T A 7: 30,876,153 (GRCm38) I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 (GRCm38) I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 (GRCm38) D370N possibly damaging Het
Diexf G T 1: 193,128,376 (GRCm38) D106E probably benign Het
Dlg2 C A 7: 92,444,508 (GRCm38) probably null Het
Dll4 A T 2: 119,333,795 (GRCm38) probably null Het
Eif5b T C 1: 38,019,027 (GRCm38) S137P probably benign Het
Epn2 A T 11: 61,533,641 (GRCm38) M250K probably damaging Het
Fat2 T A 11: 55,270,457 (GRCm38) Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 (GRCm38) S341F probably benign Het
Gm15922 T A 7: 3,738,931 (GRCm38) Y150F probably benign Het
Gm5141 A T 13: 62,774,783 (GRCm38) C191S probably damaging Het
Gm5150 C T 3: 15,990,651 (GRCm38) G137S probably damaging Het
Gm5346 T A 8: 43,626,152 (GRCm38) H345L probably damaging Het
Gpr75 C T 11: 30,891,529 (GRCm38) R145W probably damaging Het
Heatr5b G A 17: 78,753,073 (GRCm38) H2058Y probably benign Het
Ina G A 19: 47,023,561 (GRCm38) E473K probably benign Het
Itpr1 T A 6: 108,417,972 (GRCm38) M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 (GRCm38) S1383T probably benign Het
Lclat1 T A 17: 73,161,833 (GRCm38) S3T probably damaging Het
Llgl1 G A 11: 60,709,660 (GRCm38) V612M probably damaging Het
Mios A G 6: 8,231,239 (GRCm38) R708G probably benign Het
Mphosph8 T C 14: 56,688,486 (GRCm38) L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 (GRCm38) N254Y probably damaging Het
Myo7a C T 7: 98,073,167 (GRCm38) V1184M probably benign Het
Myog G A 1: 134,290,488 (GRCm38) D145N probably benign Het
Nat10 T A 2: 103,739,886 (GRCm38) I371F possibly damaging Het
Neb A T 2: 52,167,644 (GRCm38) Y229* probably null Het
Nlrp6 T A 7: 140,927,509 (GRCm38) I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 (GRCm38) S159P probably damaging Het
Olfr551 G A 7: 102,588,671 (GRCm38) A24V probably benign Het
Olfr740 A T 14: 50,453,585 (GRCm38) I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 (GRCm38) E525A probably damaging Het
Pkd2 C A 5: 104,459,924 (GRCm38) D96E probably benign Het
Prtg A G 9: 72,907,856 (GRCm38) D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 (GRCm38) M981T probably benign Het
Rc3h2 C A 2: 37,409,470 (GRCm38) A183S probably damaging Het
Rorb A T 19: 18,960,492 (GRCm38) I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 (GRCm38) R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 (GRCm38) V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 (GRCm38) I109F probably damaging Het
Spen G A 4: 141,475,509 (GRCm38) R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 (GRCm38) Y183N probably benign Het
Svil A G 18: 5,056,629 (GRCm38) K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 (GRCm38) W89* probably null Het
Tbxas1 T A 6: 38,952,145 (GRCm38) probably benign Het
Tia1 T A 6: 86,420,378 (GRCm38) I111N probably damaging Het
Tlr9 T A 9: 106,223,999 (GRCm38) L163H probably damaging Het
Tnn C T 1: 160,114,719 (GRCm38) V806M probably damaging Het
Traf5 G A 1: 191,999,926 (GRCm38) A318V probably benign Het
Ttc3 T A 16: 94,418,623 (GRCm38) M1K probably null Het
Vmn1r192 T A 13: 22,187,830 (GRCm38) R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 (GRCm38) Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 (GRCm38) N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 (GRCm38) S229R probably damaging Het
Wdr18 C T 10: 79,965,281 (GRCm38) T176I probably damaging Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 92,676,089 (GRCm38) nonsense probably null
IGL02308:Irx6 APN 8 92,677,031 (GRCm38) missense probably damaging 1.00
R0308:Irx6 UTSW 8 92,677,031 (GRCm38) missense probably damaging 1.00
R1191:Irx6 UTSW 8 92,676,952 (GRCm38) missense probably damaging 1.00
R1251:Irx6 UTSW 8 92,678,253 (GRCm38) missense possibly damaging 0.87
R4161:Irx6 UTSW 8 92,676,291 (GRCm38) missense possibly damaging 0.78
R4368:Irx6 UTSW 8 92,678,401 (GRCm38) missense probably damaging 1.00
R4924:Irx6 UTSW 8 92,678,353 (GRCm38) missense probably benign 0.25
R4950:Irx6 UTSW 8 92,678,800 (GRCm38) missense probably damaging 1.00
R5425:Irx6 UTSW 8 92,677,517 (GRCm38) critical splice donor site probably null
R6969:Irx6 UTSW 8 92,677,330 (GRCm38) missense probably damaging 1.00
R7019:Irx6 UTSW 8 92,678,734 (GRCm38) missense probably damaging 0.99
R7128:Irx6 UTSW 8 92,677,366 (GRCm38) missense probably damaging 1.00
R7133:Irx6 UTSW 8 92,678,413 (GRCm38) missense probably damaging 1.00
R8182:Irx6 UTSW 8 92,677,014 (GRCm38) nonsense probably null
R8546:Irx6 UTSW 8 92,678,636 (GRCm38) missense probably benign 0.19
R8955:Irx6 UTSW 8 92,678,412 (GRCm38) missense probably damaging 1.00
Z1176:Irx6 UTSW 8 92,678,371 (GRCm38) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGCTCAGCAGGGAGATTCTG -3'
(R):5'- ATTACTTACCAGTGCGCCAC -3'

Sequencing Primer
(F):5'- AGGGAGATTCTGCACCTGG -3'
(R):5'- TCTGGGCCATAGGTCAGGTAC -3'
Posted On 2018-05-24