Incidental Mutation 'R6455:Aldh1a2'
ID519554
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6455 (G1)
Quality Score215.009
Status Validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 71252914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723] [ENSMUST00000034723]
Predicted Effect probably null
Transcript: ENSMUST00000034723
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034723
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 probably benign Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGATGCTTTGTAGAACAACCATCC -3'
(R):5'- AATACTTTCCAGCTGAGTGGTC -3'

Sequencing Primer
(F):5'- TGCTTTGTAGAACAACCATCCATAAC -3'
(R):5'- CTGAGTGGTCATTTTGGAGTAAAAAC -3'
Posted On2018-05-24