Incidental Mutation 'R6455:Abca6'
ID519564
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6455 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110241581 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 296 (G296D)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: G296D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: G296D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150988
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 probably benign Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R8119:Abca6 UTSW 11 110197104 missense probably benign 0.00
R8139:Abca6 UTSW 11 110184133 missense probably damaging 1.00
R8176:Abca6 UTSW 11 110244194 missense probably benign 0.01
R8179:Abca6 UTSW 11 110245274 missense probably damaging 1.00
R8197:Abca6 UTSW 11 110211815 missense probably damaging 0.99
R8241:Abca6 UTSW 11 110188630 missense probably null 1.00
R8404:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8429:Abca6 UTSW 11 110202382 missense probably benign
R8502:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8816:Abca6 UTSW 11 110236687 missense probably benign 0.04
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATTCGTTTCGTATAGTCATTGGC -3'
(R):5'- AGTTATTAAACCAGGGGCACATTC -3'

Sequencing Primer
(F):5'- GTCATTGGCATTTTCTCAAACACAC -3'
(R):5'- GGGCACATTCAAGAATAATAGTGTTG -3'
Posted On2018-05-24